Search for Variation information by Variation ID:
Detailed information for vg0722741441:
| Variant ID: vg0722741441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22741441 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )
Flanking Sequence (100 bp) in Reference Genome:
GATGAAGTGGGAATCAAGCACGAGTTCTCCGCCCCTTATGATCCTCCTAAAAATGGCATTGTTGAGAGGAAGAACCGAACTCTTATTGAAGCCGCAAGAG[C/T]
AATGCTTGATAAGTACAAGACTTCGGATATCTTTTGGGCGGAGGCCGTGAGCACCGCATGCCATGCCATCAATTGCCTGTACCTCCACAAAATTCTAAAG
Reverse complement sequence
CTTTAGAATTTTGTGGAGGTACAGGCAATTGATGGCATGGCATGCGGTGCTCACGGCCTCCGCCCAAAAGATATCCGAAGTCTTGTACTTATCAAGCATT[G/A]
CTCTTGCGGCTTCAATAAGAGTTCGGTTCTTCCTCTCAACAATGCCATTTTTAGGAGGATCATAAGGGGCGGAGAACTCGTGCTTGATTCCCACTTCATC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 8.20% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 93.30% | 6.60% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 93.10% | 6.40% | 0.53% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.20% | 8.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 87.70% | 11.90% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 4.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 88.10% | 10.80% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 93.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722741441 | C -> T | LOC_Os07g37900.1 | missense_variant ; p.Ala923Val; MODERATE | nonsynonymous_codon ; A923V | Average:35.446; most accessible tissue: Minghui63 young leaf, score: 45.896 | benign  |
1.398 |
DELETERIOUS | 0.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722741441 | 1.95E-09 | 7.54E-21 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0722741441 | NA | 2.97E-13 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0722741441 | NA | 7.74E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722741441 | NA | 1.82E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722741441 | NA | 6.20E-07 | mr1544 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722741441 | NA | 3.33E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722741441 | NA | 1.12E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722741441 | NA | 6.46E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722741441 | 7.27E-08 | NA | mr1758_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722741441 | NA | 2.77E-13 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |