Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722719316:

Variant ID: vg0722719316 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22719316
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAAGGGGGGAGGAGAGAGGGCGGCGACGGCGGCTTCCGTCCCTCCTCCCAGATTCGGCCAGAGGGAGGGGATAGGCGATGGCGACGGCGCCAACGGCTC[T/C]
AAGCGGAGGCGGCGTCGCACCACCCTCAGCCCGGATCCCCTCCCCTCCCCTCCCTTCCCAGATCCGGCTGAAGGGGGCATGGGGGAGGGCGTGTTGGCCG

Reverse complement sequence

CGGCCAACACGCCCTCCCCCATGCCCCCTTCAGCCGGATCTGGGAAGGGAGGGGAGGGGAGGGGATCCGGGCTGAGGGTGGTGCGACGCCGCCTCCGCTT[A/G]
GAGCCGTTGGCGCCGTCGCCATCGCCTATCCCCTCCCTCTGGCCGAATCTGGGAGGAGGGACGGAAGCCGCCGTCGCCGCCCTCTCTCCTCCCCCCTTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 11.30% 0.08% 0.00% NA
All Indica  2759 88.50% 11.30% 0.11% 0.00% NA
All Japonica  1512 92.90% 7.00% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 81.10% 18.70% 0.22% 0.00% NA
Indica III  913 82.40% 17.40% 0.22% 0.00% NA
Indica Intermediate  786 91.60% 8.40% 0.00% 0.00% NA
Temperate Japonica  767 88.00% 12.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.40% 0.41% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722719316 T -> C LOC_Os07g37880.1 upstream_gene_variant ; 967.0bp to feature; MODIFIER silent_mutation Average:91.967; most accessible tissue: Zhenshan97 flag leaf, score: 98.608 N N N N
vg0722719316 T -> C LOC_Os07g37880-LOC_Os07g37890 intergenic_region ; MODIFIER silent_mutation Average:91.967; most accessible tissue: Zhenshan97 flag leaf, score: 98.608 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722719316 T C -0.02 -0.03 -0.03 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722719316 NA 1.82E-10 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722719316 NA 1.71E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 1.78E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 4.63E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 6.24E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 9.03E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 4.19E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 2.05E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 6.44E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 4.17E-07 4.17E-07 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 4.58E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 9.97E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 8.09E-08 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 4.37E-13 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 NA 9.52E-06 mr1922_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722719316 8.34E-07 8.34E-07 mr1940_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251