\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722706364:

Variant ID: vg0722706364 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22706364
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGACCGGAGGAGAGAAGAAACCAGTCAAAGACGCACCTGAGTCGAGCAAGAAGAAAAATCGCAAGAGTGGGAAAAGGAAAGCTCAAGCGGATGTTCTC[G/T,A]
CAACAGAATACGCGGACTCTCCCAAGCGCCCAGACCCACAAGGCAGCGACATGAAGAAAACATGGTGCCCTATACACAAGTCAGACATACACTCTCTAGA

Reverse complement sequence

TCTAGAGAGTGTATGTCTGACTTGTGTATAGGGCACCATGTTTTCTTCATGTCGCTGCCTTGTGGGTCTGGGCGCTTGGGAGAGTCCGCGTATTCTGTTG[C/A,T]
GAGAACATCCGCTTGAGCTTTCCTTTTCCCACTCTTGCGATTTTTCTTCTTGCTCGACTCAGGTGCGTCTTTGACTGGTTTCTTCTCTCCTCCGGTCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.90% 2.10% 0.00% 0.00% A: 0.02%
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 93.70% 6.30% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.00% A: 0.37%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 88.00% 12.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722706364 G -> A LOC_Os07g37860.1 missense_variant ; p.Ala694Thr; MODERATE nonsynonymous_codon ; A694T Average:38.81; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 benign 0.383 TOLERATED 0.09
vg0722706364 G -> T LOC_Os07g37860.1 missense_variant ; p.Ala694Ser; MODERATE nonsynonymous_codon ; A694S Average:38.81; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 benign 1.247 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722706364 NA 4.13E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722706364 NA 4.27E-08 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 NA 5.37E-07 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 NA 5.08E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 NA 5.19E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 NA 2.85E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 NA 8.00E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 NA 1.08E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 6.98E-06 6.98E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 NA 1.27E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 NA 5.92E-07 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 NA 1.50E-07 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 5.62E-06 5.62E-06 mr1883 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 NA 3.00E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722706364 NA 7.51E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251