Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722679457:

Variant ID: vg0722679457 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22679457
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, A: 0.37, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


AGATTGGGGAGATACGTAAAACGAGGTGAGCCATTAACTCATGATTAATTGAGTATTAACTATTTTAAATTTCAAAAATGGATTATTATGATTTTTTAAA[G/A]
CAACTTTCCTATAGAAATTTTTTGCAAAAAACGTACCGTTTAGTAGTTTAAAAAGCGTGCACGCGGAAAACGAGAATCAATCTCCCCTATTATCTCCTCA

Reverse complement sequence

TGAGGAGATAATAGGGGAGATTGATTCTCGTTTTCCGCGTGCACGCTTTTTAAACTACTAAACGGTACGTTTTTTGCAAAAAATTTCTATAGGAAAGTTG[C/T]
TTTAAAAAATCATAATAATCCATTTTTGAAATTTAAAATAGTTAATACTCAATTAATCATGAGTTAATGGCTCACCTCGTTTTACGTATCTCCCCAATCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 43.20% 0.08% 0.02% NA
All Indica  2759 80.00% 19.90% 0.11% 0.04% NA
All Japonica  1512 17.70% 82.30% 0.00% 0.00% NA
Aus  269 25.30% 74.70% 0.00% 0.00% NA
Indica I  595 99.00% 0.80% 0.17% 0.00% NA
Indica II  465 67.10% 32.90% 0.00% 0.00% NA
Indica III  913 75.70% 24.30% 0.00% 0.00% NA
Indica Intermediate  786 78.10% 21.50% 0.25% 0.13% NA
Temperate Japonica  767 2.60% 97.40% 0.00% 0.00% NA
Tropical Japonica  504 42.70% 57.30% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722679457 G -> DEL N N silent_mutation Average:79.029; most accessible tissue: Callus, score: 95.593 N N N N
vg0722679457 G -> A LOC_Os07g37810.1 upstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:79.029; most accessible tissue: Callus, score: 95.593 N N N N
vg0722679457 G -> A LOC_Os07g37810.2 upstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:79.029; most accessible tissue: Callus, score: 95.593 N N N N
vg0722679457 G -> A LOC_Os07g37820.1 downstream_gene_variant ; 1499.0bp to feature; MODIFIER silent_mutation Average:79.029; most accessible tissue: Callus, score: 95.593 N N N N
vg0722679457 G -> A LOC_Os07g37810-LOC_Os07g37820 intergenic_region ; MODIFIER silent_mutation Average:79.029; most accessible tissue: Callus, score: 95.593 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722679457 G A 0.03 0.01 0.0 -0.02 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722679457 NA 4.74E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 4.96E-06 mr1304 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 2.46E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 7.85E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 2.63E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 4.51E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 8.43E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 9.55E-07 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 4.54E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 2.30E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 7.95E-07 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 4.30E-07 mr1607_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 8.75E-06 mr1660_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 2.13E-09 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 9.65E-09 mr1691_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 1.66E-06 mr1711_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 8.45E-08 mr1720_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722679457 NA 1.99E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251