\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722678256:

Variant ID: vg0722678256 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22678256
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.27, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCGAATATACACTTTGATTTACAAAGTCACCATGGATATCGTGTCGATAGATACATCGTCTATCGATGAAAAAATAATTAGACGTATATATAATCACG[C/T]
ATGTTAAGTTTAGATCTTGAACCTAAGTGAGTAGATTCTACCAAAAGGAATTAACAAGTTATGGTCACTTCGTAGCTCTCTGATTTTCTTTTTAAAAACA

Reverse complement sequence

TGTTTTTAAAAAGAAAATCAGAGAGCTACGAAGTGACCATAACTTGTTAATTCCTTTTGGTAGAATCTACTCACTTAGGTTCAAGATCTAAACTTAACAT[G/A]
CGTGATTATATATACGTCTAATTATTTTTTCATCGATAGACGATGTATCTATCGACACGATATCCATGGTGACTTTGTAAATCAAAGTGTATATTCGCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 30.30% 0.04% 0.00% NA
All Indica  2759 94.10% 5.90% 0.00% 0.00% NA
All Japonica  1512 18.30% 81.70% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 86.00% 14.00% 0.00% 0.00% NA
Indica III  913 94.30% 5.70% 0.00% 0.00% NA
Indica Intermediate  786 94.70% 5.30% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 42.90% 57.10% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 63.30% 34.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722678256 C -> T LOC_Os07g37810.1 upstream_gene_variant ; 1507.0bp to feature; MODIFIER silent_mutation Average:53.947; most accessible tissue: Minghui63 root, score: 79.298 N N N N
vg0722678256 C -> T LOC_Os07g37810.2 upstream_gene_variant ; 1507.0bp to feature; MODIFIER silent_mutation Average:53.947; most accessible tissue: Minghui63 root, score: 79.298 N N N N
vg0722678256 C -> T LOC_Os07g37820.1 downstream_gene_variant ; 2700.0bp to feature; MODIFIER silent_mutation Average:53.947; most accessible tissue: Minghui63 root, score: 79.298 N N N N
vg0722678256 C -> T LOC_Os07g37810-LOC_Os07g37820 intergenic_region ; MODIFIER silent_mutation Average:53.947; most accessible tissue: Minghui63 root, score: 79.298 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722678256 NA 4.74E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 1.58E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 7.54E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 8.82E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 2.81E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 5.57E-07 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 1.79E-08 mr1711_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 4.80E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 1.48E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 1.42E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 9.82E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 6.72E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 3.15E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722678256 NA 3.51E-51 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251