Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0722677897:

Variant ID: vg0722677897 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22677897
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATTTTTTTTTTAATACGGTATAAGAGCAGGTACAGTAGCAGACTATTAGCCAGCTGTAAACATATTTTAATGAGATAAAAGATGAGAGAAAAAAGTAG[T/C]
GGGCTACAGATCTGTAGCCAGCTGCAGCACGGACTCCAAGACGTAATATGTGTATGACAAGTGGGACCATATATTAATAGAATAGTAAGCAACTATTATA

Reverse complement sequence

TATAATAGTTGCTTACTATTCTATTAATATATGGTCCCACTTGTCATACACATATTACGTCTTGGAGTCCGTGCTGCAGCTGGCTACAGATCTGTAGCCC[A/G]
CTACTTTTTTCTCTCATCTTTTATCTCATTAAAATATGTTTACAGCTGGCTAATAGTCTGCTACTGTACCTGCTCTTATACCGTATTAAAAAAAAAATCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 27.30% 0.00% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 18.30% 81.70% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 42.90% 57.10% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722677897 T -> C LOC_Os07g37810.1 upstream_gene_variant ; 1148.0bp to feature; MODIFIER silent_mutation Average:74.916; most accessible tissue: Minghui63 root, score: 93.081 N N N N
vg0722677897 T -> C LOC_Os07g37810.2 upstream_gene_variant ; 1148.0bp to feature; MODIFIER silent_mutation Average:74.916; most accessible tissue: Minghui63 root, score: 93.081 N N N N
vg0722677897 T -> C LOC_Os07g37820.1 downstream_gene_variant ; 3059.0bp to feature; MODIFIER silent_mutation Average:74.916; most accessible tissue: Minghui63 root, score: 93.081 N N N N
vg0722677897 T -> C LOC_Os07g37810-LOC_Os07g37820 intergenic_region ; MODIFIER silent_mutation Average:74.916; most accessible tissue: Minghui63 root, score: 93.081 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722677897 T C 0.0 0.0 0.0 0.0 -0.02 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722677897 NA 1.05E-53 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722677897 NA 4.74E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 8.70E-49 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 6.57E-91 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 1.18E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 4.55E-17 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 6.11E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 6.29E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 2.26E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 2.40E-75 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 1.83E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 4.91E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 2.21E-57 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 5.95E-06 3.33E-100 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 1.11E-33 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 7.83E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722677897 NA 2.36E-59 mr1991_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251