Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722668231:

Variant ID: vg0722668231 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 22668231
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

CATACTAGACCACAGCCAGTTGAAATGTCTTGGGTATATTGGCTCTAGGTAAAAGCTGAATATGAGGAGAGTAACTTAAACTCAGCACATCTTATTAAAA[G/T]
ATGTTTAAGAGTTGAATCGACTGTTCAAATTTCAACTACTGCTTTAGGCTACGTTCAAATCAGGAGTTAGGCTGAGCTTATCGGTGGCATTTGAAACGTG

Reverse complement sequence

CACGTTTCAAATGCCACCGATAAGCTCAGCCTAACTCCTGATTTGAACGTAGCCTAAAGCAGTAGTTGAAATTTGAACAGTCGATTCAACTCTTAAACAT[C/A]
TTTTAATAAGATGTGCTGAGTTTAAGTTACTCTCCTCATATTCAGCTTTTACCTAGAGCCAATATACCCAAGACATTTCAACTGGCTGTGGTCTAGTATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.80%	33.90%	0.28%	0.00%	NA
All Indica	2759	43.60%	55.90%	0.47%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	83.60%	16.40%	0.00%	0.00%	NA
Indica I	595	6.10%	93.30%	0.67%	0.00%	NA
Indica II	465	80.90%	18.50%	0.65%	0.00%	NA
Indica III	913	44.70%	55.10%	0.22%	0.00%	NA
Indica Intermediate	786	48.70%	50.80%	0.51%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722668231	G -> T	LOC_Os07g37790.1	downstream_gene_variant ; 4553.0bp to feature; MODIFIER	silent_mutation	Average:51.622; most accessible tissue: Callus, score: 83.741	N	N	N	N
vg0722668231	G -> T	LOC_Os07g37810.1	downstream_gene_variant ; 3181.0bp to feature; MODIFIER	silent_mutation	Average:51.622; most accessible tissue: Callus, score: 83.741	N	N	N	N
vg0722668231	G -> T	LOC_Os07g37810.2	downstream_gene_variant ; 3181.0bp to feature; MODIFIER	silent_mutation	Average:51.622; most accessible tissue: Callus, score: 83.741	N	N	N	N
vg0722668231	G -> T	LOC_Os07g37800.1	intron_variant ; MODIFIER	silent_mutation	Average:51.622; most accessible tissue: Callus, score: 83.741	N	N	N	N
vg0722668231	G -> T	LOC_Os07g37800.3	intron_variant ; MODIFIER	silent_mutation	Average:51.622; most accessible tissue: Callus, score: 83.741	N	N	N	N
vg0722668231	G -> T	LOC_Os07g37800.2	intron_variant ; MODIFIER	silent_mutation	Average:51.622; most accessible tissue: Callus, score: 83.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722668231	NA	2.72E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	5.68E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	1.65E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	6.04E-08	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	4.08E-08	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	3.21E-22	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	1.82E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	6.43E-07	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	1.03E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	4.10E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	4.14E-42	mr1598_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	3.99E-12	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	4.70E-09	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	1.62E-08	mr1928_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	1.58E-07	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	1.74E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	1.74E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722668231	NA	6.63E-12	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251