\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722597150:

Variant ID: vg0722597150 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22597150
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCCCGGTGAGGAGCCCCACGCTCCGTCAGGCAGATATTTTATAAGAATATGGAGAAGTTTCGTTTCTTAGATTATGGCTTCTAGTTAGTTTTTGAATT[T/C]
TATAACTACAATTTATCAGGATTTGGATGAAAAGCTAAATTGTTTGGAAATTTTGGGAGAAACTGGAGCTACCATAGACTCCCCAAACAAAACCCTTTGT

Reverse complement sequence

ACAAAGGGTTTTGTTTGGGGAGTCTATGGTAGCTCCAGTTTCTCCCAAAATTTCCAAACAATTTAGCTTTTCATCCAAATCCTGATAAATTGTAGTTATA[A/G]
AATTCAAAAACTAACTAGAAGCCATAATCTAAGAAACGAAACTTCTCCATATTCTTATAAAATATCTGCCTGACGGAGCGTGGGGCTCCTCACCGGGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 25.10% 0.02% 0.30% NA
All Indica  2759 98.70% 1.10% 0.00% 0.29% NA
All Japonica  1512 24.90% 74.70% 0.07% 0.26% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.00% 0.17% NA
Indica II  465 94.60% 4.50% 0.00% 0.86% NA
Indica III  913 99.60% 0.30% 0.00% 0.11% NA
Indica Intermediate  786 99.20% 0.50% 0.00% 0.25% NA
Temperate Japonica  767 17.20% 82.40% 0.13% 0.26% NA
Tropical Japonica  504 41.70% 58.30% 0.00% 0.00% NA
Japonica Intermediate  241 14.50% 84.60% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 66.70% 31.10% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722597150 T -> DEL N N silent_mutation Average:74.233; most accessible tissue: Zhenshan97 flower, score: 96.899 N N N N
vg0722597150 T -> C LOC_Os07g37690.1 upstream_gene_variant ; 506.0bp to feature; MODIFIER silent_mutation Average:74.233; most accessible tissue: Zhenshan97 flower, score: 96.899 N N N N
vg0722597150 T -> C LOC_Os07g37680.1 downstream_gene_variant ; 2509.0bp to feature; MODIFIER silent_mutation Average:74.233; most accessible tissue: Zhenshan97 flower, score: 96.899 N N N N
vg0722597150 T -> C LOC_Os07g37700.1 downstream_gene_variant ; 4915.0bp to feature; MODIFIER silent_mutation Average:74.233; most accessible tissue: Zhenshan97 flower, score: 96.899 N N N N
vg0722597150 T -> C LOC_Os07g37680.2 downstream_gene_variant ; 2510.0bp to feature; MODIFIER silent_mutation Average:74.233; most accessible tissue: Zhenshan97 flower, score: 96.899 N N N N
vg0722597150 T -> C LOC_Os07g37680-LOC_Os07g37690 intergenic_region ; MODIFIER silent_mutation Average:74.233; most accessible tissue: Zhenshan97 flower, score: 96.899 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722597150 T C -0.02 0.0 0.01 -0.02 -0.01 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722597150 2.34E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 1.05E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 2.71E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 6.50E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 2.72E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 1.31E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 7.05E-07 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 2.62E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 6.98E-27 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 1.61E-06 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 2.66E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 9.50E-06 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 1.03E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 1.71E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 1.53E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 8.00E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 9.88E-07 NA mr1618 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 2.68E-07 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 2.47E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 4.52E-06 4.52E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 7.05E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 1.27E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 1.83E-13 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 1.23E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 8.10E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 2.24E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 7.03E-08 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 6.52E-17 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 2.03E-13 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 2.23E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722597150 NA 1.58E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251