\
| Variant ID: vg0722586628 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22586628 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 331. )
GGGTTGCGCTCGAGTGTGGTCCAATTTGTGCAAGCCTGTTCGATCTGTCAAAAGGCGAAATCTGAACATGTCAAATATCCTGGTATGTTGCAACCTTTAC[T/C]
AGTGCCTGAACATGCTTGGCAAGTGGTCTCGTTGGACTTTATTGAAGGTTTACCACGCTCATCTTCGTTTAACTGCATTTTGGTGGTCGTTGACAAATTT
AAATTTGTCAACGACCACCAAAATGCAGTTAAACGAAGATGAGCGTGGTAAACCTTCAATAAAGTCCAACGAGACCACTTGCCAAGCATGTTCAGGCACT[A/G]
GTAAAGGTTGCAACATACCAGGATATTTGACATGTTCAGATTTCGCCTTTTGACAGATCGAACAGGCTTGCACAAATTGGACCACACTCGAGCGCAACCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 25.10% | 0.00% | 0.36% | NA |
| All Indica | 2759 | 98.60% | 1.10% | 0.00% | 0.33% | NA |
| All Japonica | 1512 | 25.10% | 74.50% | 0.00% | 0.40% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.00% | 0.17% | NA |
| Indica II | 465 | 94.40% | 4.50% | 0.00% | 1.08% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.20% | 0.50% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 17.50% | 82.00% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 41.70% | 58.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.90% | 84.20% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 32.20% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722586628 | T -> DEL | LOC_Os07g37670.1 | N | frameshift_variant | Average:47.629; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| vg0722586628 | T -> C | LOC_Os07g37670.1 | missense_variant ; p.Leu1078Pro; MODERATE | nonsynonymous_codon ; L1078P | Average:47.629; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | benign |
-0.378 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722586628 | NA | 1.35E-07 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0722586628 | NA | 6.07E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 9.22E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 2.12E-06 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 2.99E-26 | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 6.92E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 2.51E-17 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 3.93E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 2.00E-06 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 7.56E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 1.48E-09 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 1.01E-12 | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 7.96E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 3.51E-25 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 2.06E-07 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 1.80E-17 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 1.28E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 4.86E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 1.18E-14 | mr1667_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 1.61E-09 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 1.04E-12 | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 4.67E-16 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 2.30E-19 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 4.49E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 1.55E-07 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722586628 | NA | 1.61E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |