Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722579980:

Variant ID: vg0722579980 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 22579980
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTCAACTTACAAAACCAATACAAACTAGGTCCCTCGGCAGTTTTGACTCCGGTTTTATCCGACATAGCAACTGACTCAGTGTGGGACTCACGTGGGCCC[C/G]
ACACGTCAACCTCTTCTTCCCCTCCCATCTCCACCTTTCTTTCTCTCTCCTCTCCTTTCTCTTCTCTATATTGACCACAACCCGCTCGTCATGCCGCCCA

Reverse complement sequence

TGGGCGGCATGACGAGCGGGTTGTGGTCAATATAGAGAAGAGAAAGGAGAGGAGAGAGAAAGAAAGGTGGAGATGGGAGGGGAAGAAGAGGTTGACGTGT[G/C]
GGGCCCACGTGAGTCCCACACTGAGTCAGTTGCTATGTCGGATAAAACCGGAGTCAAAACTGCCGAGGGACCTAGTTTGTATTGGTTTTGTAAGTTGAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	40.20%	0.42%	0.00%	NA
All Indica	2759	84.60%	15.00%	0.43%	0.00%	NA
All Japonica	1512	24.40%	75.20%	0.40%	0.00%	NA
Aus	269	24.20%	75.80%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	74.60%	24.10%	1.29%	0.00%	NA
Indica III	913	77.50%	22.10%	0.33%	0.00%	NA
Indica Intermediate	786	87.00%	12.60%	0.38%	0.00%	NA
Temperate Japonica	767	17.30%	82.10%	0.52%	0.00%	NA
Tropical Japonica	504	42.10%	57.90%	0.00%	0.00%	NA
Japonica Intermediate	241	10.00%	89.20%	0.83%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	42.20%	55.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722579980	C -> G	LOC_Os07g37650.1	upstream_gene_variant ; 2033.0bp to feature; MODIFIER	silent_mutation	Average:80.171; most accessible tissue: Minghui63 root, score: 86.877	N	N	N	N
vg0722579980	C -> G	LOC_Os07g37660.1	upstream_gene_variant ; 91.0bp to feature; MODIFIER	silent_mutation	Average:80.171; most accessible tissue: Minghui63 root, score: 86.877	N	N	N	N
vg0722579980	C -> G	LOC_Os07g37670.1	upstream_gene_variant ; 2973.0bp to feature; MODIFIER	silent_mutation	Average:80.171; most accessible tissue: Minghui63 root, score: 86.877	N	N	N	N
vg0722579980	C -> G	LOC_Os07g37650-LOC_Os07g37660	intergenic_region ; MODIFIER	silent_mutation	Average:80.171; most accessible tissue: Minghui63 root, score: 86.877	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722579980	1.14E-06	NA	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722579980	3.94E-06	NA	mr1301	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722579980	NA	1.30E-11	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722579980	NA	3.25E-07	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722579980	NA	8.71E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722579980	NA	1.49E-10	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251