\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722546543:

Variant ID: vg0722546543 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22546543
Reference Allele: GAlternative Allele: A,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TCGACGACGGGTGCACGTAGCAGCACAGGTGTTGAGCGTTTTGACTGACGTGCGGTGGACGGCACGCGCGCGCGGTGATTTTCATACGAGGGTGTGTAGT[G/A,C]
CTCCTACGTACTACCGGAGTACTCCGTAATTGTTAATTTCCACCGTGCGCGCGTGTCCATGTACGACGCACTACGTGGCCCGATCGGTCACGTTCTACCT

Reverse complement sequence

AGGTAGAACGTGACCGATCGGGCCACGTAGTGCGTCGTACATGGACACGCGCGCACGGTGGAAATTAACAATTACGGAGTACTCCGGTAGTACGTAGGAG[C/T,G]
ACTACACACCCTCGTATGAAAATCACCGCGCGCGCGTGCCGTCCACCGCACGTCAGTCAAAACGCTCAACACCTGTGCTGCTACGTGCACCCGTCGTCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 30.00% 0.23% 0.00% C: 0.02%
All Indica  2759 96.10% 3.70% 0.22% 0.00% NA
All Japonica  1512 14.60% 85.10% 0.20% 0.00% C: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 94.20% 5.20% 0.65% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 91.70% 8.00% 0.25% 0.00% NA
Temperate Japonica  767 15.10% 84.60% 0.13% 0.00% C: 0.13%
Tropical Japonica  504 15.10% 84.90% 0.00% 0.00% NA
Japonica Intermediate  241 12.00% 87.10% 0.83% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 66.70% 31.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722546543 G -> A LOC_Os07g37620.1 upstream_gene_variant ; 1588.0bp to feature; MODIFIER silent_mutation Average:94.905; most accessible tissue: Callus, score: 99.136 N N N N
vg0722546543 G -> A LOC_Os07g37610.1 downstream_gene_variant ; 3760.0bp to feature; MODIFIER silent_mutation Average:94.905; most accessible tissue: Callus, score: 99.136 N N N N
vg0722546543 G -> A LOC_Os07g37620-LOC_Os07g37630 intergenic_region ; MODIFIER silent_mutation Average:94.905; most accessible tissue: Callus, score: 99.136 N N N N
vg0722546543 G -> C LOC_Os07g37620.1 upstream_gene_variant ; 1588.0bp to feature; MODIFIER silent_mutation Average:94.905; most accessible tissue: Callus, score: 99.136 N N N N
vg0722546543 G -> C LOC_Os07g37610.1 downstream_gene_variant ; 3760.0bp to feature; MODIFIER silent_mutation Average:94.905; most accessible tissue: Callus, score: 99.136 N N N N
vg0722546543 G -> C LOC_Os07g37620-LOC_Os07g37630 intergenic_region ; MODIFIER silent_mutation Average:94.905; most accessible tissue: Callus, score: 99.136 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722546543 G A 0.11 0.09 0.05 0.02 0.04 0.02
vg0722546543 G C 0.07 -0.01 -0.03 0.0 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722546543 NA 1.01E-07 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722546543 7.41E-06 4.43E-08 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 4.31E-07 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 2.03E-07 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 3.37E-08 mr1140 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 7.50E-06 3.69E-08 mr1203 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 6.54E-06 1.47E-08 mr1395 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 4.00E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 3.31E-09 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 9.10E-06 2.89E-08 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 8.80E-09 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 3.09E-13 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 1.84E-07 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 7.64E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 4.83E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 5.31E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 3.38E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 8.40E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 1.17E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722546543 NA 9.59E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251