| Variant ID: vg0722528393 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22528393 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTACGCGTGGCAGTCCAGTCATTATTCTATTTATAAAAAATATATATAGGACCCACATGTCCTCCTCTCTCTCTCACTCTTCCCCTCTCTCTCACGGGTC[A/G]
GCGAAGGCGGCGGCGGGGGATGAGGAGGACAACGAGGATGTTGACCGGGTAATTCGTACTTTTTCCTTTAAAAATTGCCTAGAAAACTTTTACTCTAGAG
CTCTAGAGTAAAAGTTTTCTAGGCAATTTTTAAAGGAAAAAGTACGAATTACCCGGTCAACATCCTCGTTGTCCTCCTCATCCCCCGCCGCCGCCTTCGC[T/C]
GACCCGTGAGAGAGAGGGGAAGAGTGAGAGAGAGAGGAGGACATGTGGGTCCTATATATATTTTTTATAAATAGAATAATGACTGGACTGCCACGCGTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 33.50% | 0.85% | 0.00% | NA |
| All Indica | 2759 | 87.90% | 10.80% | 1.34% | 0.00% | NA |
| All Japonica | 1512 | 23.60% | 76.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.50% | 0.20% | 2.35% | 0.00% | NA |
| Indica II | 465 | 84.70% | 14.20% | 1.08% | 0.00% | NA |
| Indica III | 913 | 79.20% | 20.30% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 92.50% | 5.90% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 16.80% | 83.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 40.50% | 59.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.00% | 90.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 50.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722528393 | A -> G | LOC_Os07g37590-LOC_Os07g37600 | intergenic_region ; MODIFIER | silent_mutation | Average:49.029; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722528393 | NA | 4.98E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722528393 | NA | 2.36E-07 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722528393 | NA | 3.52E-10 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722528393 | NA | 2.63E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722528393 | NA | 6.38E-06 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722528393 | NA | 5.05E-12 | mr1970_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722528393 | NA | 4.15E-12 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |