Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722493510:

Variant ID: vg0722493510 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 22493510
Reference Allele: CA	Alternative Allele: C,AA
Primary Allele: CA	Secondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCAGTCAATTCCATCCTCTAAGTATTCCTGAAAAAAGTGTAGAGTTAGCACTGATATAGGGGATAAAAGCATGAGACTACCAGCTTTAACACACACCCC[CA/C,AA]
AAAAAAAAAAAGATAAAAGCAATTGTGCTGCCAAATAGCAAAATTCAGTAGCAGCTTATGAGTGAGCAGAGTCTGATATTACACTAAGAATCAAAGCTGT

Reverse complement sequence

ACAGCTTTGATTCTTAGTGTAATATCAGACTCTGCTCACTCATAAGCTGCTACTGAATTTTGCTATTTGGCAGCACAATTGCTTTTATCTTTTTTTTTTT[TG/G,TT]
GGGGTGTGTGTTAAAGCTGGTAGTCTCATGCTTTTATCCCCTATATCAGTGCTAACTCTACACTTTTTTCAGGAATACTTAGAGGATGGAATTGACTGGG

Allele Frequencies:

Populations	Population Size	Frequency of CA(primary allele)	Frequency of AA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.60%	28.10%	2.84%	0.59%	C: 15.89%
All Indica	2759	70.10%	14.30%	3.91%	1.01%	C: 10.62%
All Japonica	1512	31.20%	57.50%	1.12%	0.00%	C: 10.12%
Aus	269	16.70%	10.00%	0.37%	0.00%	C: 72.86%
Indica I	595	88.90%	4.50%	5.55%	0.00%	C: 1.01%
Indica II	465	69.50%	18.90%	1.51%	0.22%	C: 9.89%
Indica III	913	61.00%	19.60%	2.74%	1.97%	C: 14.68%
Indica Intermediate	786	66.90%	12.80%	5.47%	1.15%	C: 13.61%
Temperate Japonica	767	55.50%	41.20%	0.91%	0.00%	C: 2.35%
Tropical Japonica	504	3.60%	71.20%	1.59%	0.00%	C: 23.61%
Japonica Intermediate	241	11.60%	80.90%	0.83%	0.00%	C: 6.64%
VI/Aromatic	96	2.10%	0.00%	3.12%	0.00%	C: 94.79%
Intermediate	90	35.60%	38.90%	5.56%	0.00%	C: 20.00%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722493510	CA -> DEL	N	N	silent_mutation	Average:57.464; most accessible tissue: Callus, score: 84.301	N	N	N	N
vg0722493510	CA -> AA	LOC_Os07g37550.1	downstream_gene_variant ; 4744.0bp to feature; MODIFIER	silent_mutation	Average:57.464; most accessible tissue: Callus, score: 84.301	N	N	N	N
vg0722493510	CA -> AA	LOC_Os07g37560.1	intron_variant ; MODIFIER	silent_mutation	Average:57.464; most accessible tissue: Callus, score: 84.301	N	N	N	N
vg0722493510	CA -> AA	LOC_Os07g37560.3	intron_variant ; MODIFIER	silent_mutation	Average:57.464; most accessible tissue: Callus, score: 84.301	N	N	N	N
vg0722493510	CA -> AA	LOC_Os07g37560.2	intron_variant ; MODIFIER	silent_mutation	Average:57.464; most accessible tissue: Callus, score: 84.301	N	N	N	N
vg0722493510	CA -> C	LOC_Os07g37550.1	downstream_gene_variant ; 4745.0bp to feature; MODIFIER	silent_mutation	Average:57.464; most accessible tissue: Callus, score: 84.301	N	N	N	N
vg0722493510	CA -> C	LOC_Os07g37560.1	intron_variant ; MODIFIER	silent_mutation	Average:57.464; most accessible tissue: Callus, score: 84.301	N	N	N	N
vg0722493510	CA -> C	LOC_Os07g37560.3	intron_variant ; MODIFIER	silent_mutation	Average:57.464; most accessible tissue: Callus, score: 84.301	N	N	N	N
vg0722493510	CA -> C	LOC_Os07g37560.2	intron_variant ; MODIFIER	silent_mutation	Average:57.464; most accessible tissue: Callus, score: 84.301	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722493510	NA	3.71E-06	mr1045	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	5.46E-07	mr1081	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	6.65E-06	mr1106	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	3.39E-06	mr1123	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	3.95E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	1.40E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	6.95E-06	mr1222	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	7.77E-06	7.77E-06	mr1287	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	8.45E-10	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	1.25E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	3.03E-06	mr1372	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	1.73E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	1.98E-07	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	1.77E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	3.39E-06	mr1432	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	1.08E-09	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	8.33E-09	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	8.93E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	5.17E-06	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	4.66E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	1.90E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	2.48E-07	2.48E-07	mr1784	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	1.04E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	1.27E-07	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	2.28E-06	2.28E-06	mr1840	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	5.68E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	2.33E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	4.58E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	2.82E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	1.65E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	1.42E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722493510	NA	4.79E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251