\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722483807:

Variant ID: vg0722483807 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22483807
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCGTTAAGACATTGTTTAATACTATTAAGACACTATTTAGCACTGTTGAGGCATTGTTTAGTACTATTGGGCACTGTTCATATAGCCAGTGCCACACG[A/G]
CTAGGGCTGGACGAAAAGCTCGTGACTCATTGGCTTGCTCGGCTCGTTGTTAGCTCGGCTCGGCTCGACTCGGCTCGTTACATTTTCTTAACGAGCTGAG

Reverse complement sequence

CTCAGCTCGTTAAGAAAATGTAACGAGCCGAGTCGAGCCGAGCCGAGCTAACAACGAGCCGAGCAAGCCAATGAGTCACGAGCTTTTCGTCCAGCCCTAG[T/C]
CGTGTGGCACTGGCTATATGAACAGTGCCCAATAGTACTAAACAATGCCTCAACAGTGCTAAATAGTGTCTTAATAGTATTAAACAATGTCTTAACGGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.00% 42.80% 0.21% 4.93% NA
All Indica  2759 27.90% 70.70% 0.29% 1.09% NA
All Japonica  1512 99.10% 0.90% 0.07% 0.00% NA
Aus  269 9.30% 16.40% 0.00% 74.35% NA
Indica I  595 1.50% 98.50% 0.00% 0.00% NA
Indica II  465 38.50% 60.20% 0.65% 0.65% NA
Indica III  913 41.00% 58.50% 0.22% 0.33% NA
Indica Intermediate  786 26.50% 70.10% 0.38% 3.05% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 78.90% 17.80% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722483807 A -> DEL N N silent_mutation Average:96.488; most accessible tissue: Callus, score: 99.059 N N N N
vg0722483807 A -> G LOC_Os07g37540.1 upstream_gene_variant ; 2324.0bp to feature; MODIFIER silent_mutation Average:96.488; most accessible tissue: Callus, score: 99.059 N N N N
vg0722483807 A -> G LOC_Os07g37550.1 upstream_gene_variant ; 3614.0bp to feature; MODIFIER silent_mutation Average:96.488; most accessible tissue: Callus, score: 99.059 N N N N
vg0722483807 A -> G LOC_Os07g37530-LOC_Os07g37540 intergenic_region ; MODIFIER silent_mutation Average:96.488; most accessible tissue: Callus, score: 99.059 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722483807 A G 0.06 0.03 0.03 0.04 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722483807 NA 5.63E-16 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 6.60E-10 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 8.08E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 3.83E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 1.59E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 2.38E-28 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 3.39E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 6.48E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 5.34E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 3.51E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 3.18E-21 mr1146_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 4.03E-06 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 3.05E-16 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 2.61E-34 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 2.44E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 2.16E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 8.58E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 9.95E-08 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 3.91E-06 mr1863_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 6.25E-16 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 3.34E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722483807 NA 4.98E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251