\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722461595:

Variant ID: vg0722461595 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22461595
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TATACTGGTTCAGGCCGGTAGGTAATAGCCCTAATCCAGTTGGTATGGAATTATACGATGAAAATCATAGATTACAAAGGGAATAACAGAACTTGATGAT[A/T]
CCGATGAGACCGTAGTCGAGTTGGTTCGACTAGATCACCCGGCAACTTAGCTCCTGTAGGCTCCGGCTTCGTAGGCTATGGTGGATGTGTTAGCGGTGAT

Reverse complement sequence

ATCACCGCTAACACATCCACCATAGCCTACGAAGCCGGAGCCTACAGGAGCTAAGTTGCCGGGTGATCTAGTCGAACCAACTCGACTACGGTCTCATCGG[T/A]
ATCATCAAGTTCTGTTATTCCCTTTGTAATCTATGATTTTCATCGTATAATTCCATACCAACTGGATTAGGGCTATTACCTACCGGCCTGAACCAGTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 14.40% 0.02% 0.38% NA
All Indica  2759 86.80% 12.50% 0.00% 0.65% NA
All Japonica  1512 94.20% 5.80% 0.00% 0.00% NA
Aus  269 16.40% 83.60% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 85.20% 14.80% 0.00% 0.00% NA
Indica III  913 79.10% 18.90% 0.00% 1.97% NA
Indica Intermediate  786 87.20% 12.80% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 85.50% 14.50% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722461595 A -> DEL N N silent_mutation Average:47.44; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0722461595 A -> T LOC_Os07g37510.1 upstream_gene_variant ; 3066.0bp to feature; MODIFIER silent_mutation Average:47.44; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0722461595 A -> T LOC_Os07g37520.1 downstream_gene_variant ; 4054.0bp to feature; MODIFIER silent_mutation Average:47.44; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0722461595 A -> T LOC_Os07g37510-LOC_Os07g37520 intergenic_region ; MODIFIER silent_mutation Average:47.44; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722461595 NA 7.81E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 2.16E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 3.40E-06 3.39E-06 mr1175 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 6.38E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 1.03E-06 mr1227 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 7.29E-06 7.29E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 3.24E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 5.65E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 2.05E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 2.05E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 2.75E-06 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 2.27E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 3.13E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 3.28E-06 mr1614 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 3.07E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 2.87E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 8.06E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 8.29E-06 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 2.70E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 3.30E-07 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 3.77E-07 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 1.09E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722461595 NA 8.53E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251