\
| Variant ID: vg0722461551 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22461551 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 241. )
CAAGGATACGTAGTACGACATCAAGCAAACAACAAAAGACAGATTATACTGGTTCAGGCCGGTAGGTAATAGCCCTAATCCAGTTGGTATGGAATTATAC[G/A]
ATGAAAATCATAGATTACAAAGGGAATAACAGAACTTGATGATACCGATGAGACCGTAGTCGAGTTGGTTCGACTAGATCACCCGGCAACTTAGCTCCTG
CAGGAGCTAAGTTGCCGGGTGATCTAGTCGAACCAACTCGACTACGGTCTCATCGGTATCATCAAGTTCTGTTATTCCCTTTGTAATCTATGATTTTCAT[C/T]
GTATAATTCCATACCAACTGGATTAGGGCTATTACCTACCGGCCTGAACCAGTATAATCTGTCTTTTGTTGTTTGCTTGATGTCGTACTACGTATCCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.10% | 36.40% | 0.15% | 0.32% | NA |
| All Indica | 2759 | 80.80% | 18.60% | 0.11% | 0.54% | NA |
| All Japonica | 1512 | 37.60% | 62.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 16.40% | 83.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 72.50% | 27.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 71.10% | 27.20% | 0.22% | 1.53% | NA |
| Indica Intermediate | 786 | 83.10% | 16.80% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 53.80% | 45.80% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 23.60% | 76.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.90% | 85.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722461551 | G -> DEL | N | N | silent_mutation | Average:48.338; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0722461551 | G -> A | LOC_Os07g37510.1 | upstream_gene_variant ; 3022.0bp to feature; MODIFIER | silent_mutation | Average:48.338; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0722461551 | G -> A | LOC_Os07g37520.1 | downstream_gene_variant ; 4098.0bp to feature; MODIFIER | silent_mutation | Average:48.338; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0722461551 | G -> A | LOC_Os07g37510-LOC_Os07g37520 | intergenic_region ; MODIFIER | silent_mutation | Average:48.338; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722461551 | NA | 2.91E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 7.08E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 1.20E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | 8.25E-06 | NA | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 5.46E-09 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 3.00E-15 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 8.52E-06 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 3.92E-09 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | 3.25E-06 | NA | mr1902 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 1.87E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 2.60E-06 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 2.42E-07 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 8.19E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 7.12E-07 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 7.77E-07 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 5.44E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722461551 | NA | 1.71E-06 | mr1863_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |