Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722450841:

Variant ID: vg0722450841 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22450841
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTACTTATTTATAGTTTATCTATCAGCTCACTCATATAGTGGTTAACTCTTCACTATAAATATATGGTCCACATGTCTATCTCACAGATTTTCTTGGTT[C/T]
CTGTGCCTACGACGGCTGTAAACTTATAACCCGCTTCTCATCTCTCTCCTCTTATCTCCCATCCACCTCAGCATTCAGCTTTCTTATAGCCTATTATACT

Reverse complement sequence

AGTATAATAGGCTATAAGAAAGCTGAATGCTGAGGTGGATGGGAGATAAGAGGAGAGAGATGAGAAGCGGGTTATAAGTTTACAGCCGTCGTAGGCACAG[G/A]
AACCAAGAAAATCTGTGAGATAGACATGTGGACCATATATTTATAGTGAAGAGTTAACCACTATATGAGTGAGCTGATAGATAAACTATAAATAAGTAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 18.70% 0.04% 0.00% NA
All Indica  2759 99.30% 0.70% 0.04% 0.00% NA
All Japonica  1512 43.70% 56.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.40% 2.40% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 54.20% 45.80% 0.00% 0.00% NA
Tropical Japonica  504 38.10% 61.90% 0.00% 0.00% NA
Japonica Intermediate  241 21.60% 78.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722450841 C -> T LOC_Os07g37500.1 upstream_gene_variant ; 3291.0bp to feature; MODIFIER silent_mutation Average:87.617; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0722450841 C -> T LOC_Os07g37490.1 downstream_gene_variant ; 1234.0bp to feature; MODIFIER silent_mutation Average:87.617; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0722450841 C -> T LOC_Os07g37490-LOC_Os07g37500 intergenic_region ; MODIFIER silent_mutation Average:87.617; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722450841 C T -0.01 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722450841 NA 5.84E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 4.38E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 2.50E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 7.64E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 1.88E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 1.08E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 1.72E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 1.86E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 5.38E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 1.14E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 4.20E-10 mr1604 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 2.65E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 1.93E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 1.93E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 9.62E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 9.42E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 8.18E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 1.74E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722450841 NA 4.46E-08 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251