\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722277880:

Variant ID: vg0722277880 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22277880
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGAGAGATGGCGTGAGAGGATACATTGGAAAACATAAGTAGATCCTCTAACTTACAGTTCTCTAACTTTGAGAGACCGGTATATAAGCCCCAACAACT[C/T]
GTGGATCCACACGTCATCCACCCACATTAGATGAGCCTCTTCCATCTAAAAAACACGTGCCACGTATTGTTAAGTTGTCCTAACTTTTATAGAAATAATC

Reverse complement sequence

GATTATTTCTATAAAAGTTAGGACAACTTAACAATACGTGGCACGTGTTTTTTAGATGGAAGAGGCTCATCTAATGTGGGTGGATGACGTGTGGATCCAC[G/A]
AGTTGTTGGGGCTTATATACCGGTCTCTCAAAGTTAGAGAACTGTAAGTTAGAGGATCTACTTATGTTTTCCAATGTATCCTCTCACGCCATCTCTCCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 20.40% 0.19% 0.30% NA
All Indica  2759 78.90% 20.20% 0.33% 0.51% NA
All Japonica  1512 93.70% 6.30% 0.00% 0.00% NA
Aus  269 21.20% 78.80% 0.00% 0.00% NA
Indica I  595 92.90% 6.10% 0.50% 0.50% NA
Indica II  465 84.50% 14.60% 0.43% 0.43% NA
Indica III  913 69.40% 29.90% 0.11% 0.55% NA
Indica Intermediate  786 76.10% 23.00% 0.38% 0.51% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 85.70% 14.30% 0.00% 0.00% NA
Japonica Intermediate  241 90.90% 9.10% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722277880 C -> DEL N N silent_mutation Average:82.784; most accessible tissue: Zhenshan97 flower, score: 92.272 N N N N
vg0722277880 C -> T LOC_Os07g37180.1 upstream_gene_variant ; 4264.0bp to feature; MODIFIER silent_mutation Average:82.784; most accessible tissue: Zhenshan97 flower, score: 92.272 N N N N
vg0722277880 C -> T LOC_Os07g37190.1 upstream_gene_variant ; 3296.0bp to feature; MODIFIER silent_mutation Average:82.784; most accessible tissue: Zhenshan97 flower, score: 92.272 N N N N
vg0722277880 C -> T LOC_Os07g37180.2 upstream_gene_variant ; 4264.0bp to feature; MODIFIER silent_mutation Average:82.784; most accessible tissue: Zhenshan97 flower, score: 92.272 N N N N
vg0722277880 C -> T LOC_Os07g37180-LOC_Os07g37190 intergenic_region ; MODIFIER silent_mutation Average:82.784; most accessible tissue: Zhenshan97 flower, score: 92.272 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722277880 C T 0.0 0.02 0.0 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722277880 NA 4.30E-06 mr1627 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251