\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722277838:

Variant ID: vg0722277838 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 22277838
Reference Allele: GTTCAlternative Allele: TTTC,G
Primary Allele: GTTCSecondary Allele: TTTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAAAGAGACTATGATATAATCTAGCGCTGCAGGACAAGGATGTGGAGAGATGGCGTGAGAGGATACATTGGAAAACATAAGTAGATCCTCTAACTTACA[GTTC/TTTC,G]
TCTAACTTTGAGAGACCGGTATATAAGCCCCAACAACTCGTGGATCCACACGTCATCCACCCACATTAGATGAGCCTCTTCCATCTAAAAAACACGTGCC

Reverse complement sequence

GGCACGTGTTTTTTAGATGGAAGAGGCTCATCTAATGTGGGTGGATGACGTGTGGATCCACGAGTTGTTGGGGCTTATATACCGGTCTCTCAAAGTTAGA[GAAC/GAAA,C]
TGTAAGTTAGAGGATCTACTTATGTTTTCCAATGTATCCTCTCACGCCATCTCTCCACATCCTTGTCCTGCAGCGCTAGATTATATCATAGTCTCTTTTA

Allele Frequencies:

Populations Population SizeFrequency of GTTC(primary allele) Frequency of TTTC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.60% 6.40% 0.02% 0.00% G: 0.02%
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 80.50% 19.40% 0.00% 0.00% G: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 64.00% 36.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.00% 0.00% G: 0.20%
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722277838 GTTC -> G LOC_Os07g37180.1 upstream_gene_variant ; 4223.0bp to feature; MODIFIER silent_mutation Average:84.586; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0722277838 GTTC -> G LOC_Os07g37190.1 upstream_gene_variant ; 3337.0bp to feature; MODIFIER silent_mutation Average:84.586; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0722277838 GTTC -> G LOC_Os07g37180.2 upstream_gene_variant ; 4223.0bp to feature; MODIFIER silent_mutation Average:84.586; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0722277838 GTTC -> G LOC_Os07g37180-LOC_Os07g37190 intergenic_region ; MODIFIER silent_mutation Average:84.586; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0722277838 GTTC -> TTTC LOC_Os07g37180.1 upstream_gene_variant ; 4222.0bp to feature; MODIFIER silent_mutation Average:84.586; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0722277838 GTTC -> TTTC LOC_Os07g37190.1 upstream_gene_variant ; 3338.0bp to feature; MODIFIER silent_mutation Average:84.586; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0722277838 GTTC -> TTTC LOC_Os07g37180.2 upstream_gene_variant ; 4222.0bp to feature; MODIFIER silent_mutation Average:84.586; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0722277838 GTTC -> TTTC LOC_Os07g37180-LOC_Os07g37190 intergenic_region ; MODIFIER silent_mutation Average:84.586; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722277838 GTTC G 0.12 0.05 -0.12 0.11 0.13 0.14
vg0722277838 GTTC TTTC -0.03 -0.03 -0.02 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722277838 NA 4.00E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722277838 NA 4.92E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722277838 NA 2.35E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722277838 NA 2.40E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722277838 NA 2.34E-08 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722277838 NA 5.55E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722277838 NA 7.85E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722277838 1.10E-07 NA mr1765_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722277838 NA 1.03E-08 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722277838 NA 8.90E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722277838 NA 2.07E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251