\
| Variant ID: vg0722270556 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22270556 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 191. )
AATTGTGGTAGCATATAACGTTATGAAATTAATCTTAATAGGAAATCTAGTAATACAGTTTTCAATATTTTGTACATCAAATCTAGATCTAAACTGATAA[G/A]
AAAATCAGATTCCAATACATGAAAATGCCTATACAGTACAAAGGGTGACTACTTCGAGCAAAGATTAGCCTATTGAAGAAGTCACGTTCTGAAACCAAAG
CTTTGGTTTCAGAACGTGACTTCTTCAATAGGCTAATCTTTGCTCGAAGTAGTCACCCTTTGTACTGTATAGGCATTTTCATGTATTGGAATCTGATTTT[C/T]
TTATCAGTTTAGATCTAGATTTGATGTACAAAATATTGAAAACTGTATTACTAGATTTCCTATTAAGATTAATTTCATAACGTTATATGCTACCACAATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 37.30% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 7.40% | 92.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 51.70% | 48.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 89.90% | 9.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 14.30% | 85.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.00% | 90.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 26.00% | 72.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 51.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722270556 | G -> A | LOC_Os07g37180.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.485; most accessible tissue: Callus, score: 80.034 | N | N | N | N |
| vg0722270556 | G -> A | LOC_Os07g37180.2 | intron_variant ; MODIFIER | silent_mutation | Average:44.485; most accessible tissue: Callus, score: 80.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722270556 | NA | 4.39E-07 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 2.30E-31 | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 3.36E-08 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 1.18E-11 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 5.91E-25 | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 4.26E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 2.05E-16 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 2.12E-07 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 1.17E-08 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 4.02E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 4.68E-16 | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 8.13E-07 | mr1949 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 5.20E-32 | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 5.27E-38 | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 2.03E-37 | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | 6.13E-06 | 2.14E-29 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 4.41E-06 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 1.86E-51 | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | NA | 5.84E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722270556 | 7.93E-06 | 3.06E-27 | mr1949_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |