| Variant ID: vg0722226606 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22226606 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TACAATTTAGAAGTAACTGAAATTTGAAATTAAAAATTAAAGAATATTGAAAGATAAGTTTAGAGTCCACATAGAAATACAATTAGAAATAATAAAAATT[C/T]
AGAATTAAAAAAGAAATATTAAAAAGCGAGTCTAGAGTCCATATAGGAATATATATAATTTACAAATAACTAAAATTTTATATTATAAATAATTAATAAC
GTTATTAATTATTTATAATATAAAATTTTAGTTATTTGTAAATTATATATATTCCTATATGGACTCTAGACTCGCTTTTTAATATTTCTTTTTTAATTCT[G/A]
AATTTTTATTATTTCTAATTGTATTTCTATGTGGACTCTAAACTTATCTTTCAATATTCTTTAATTTTTAATTTCAAATTTCAGTTACTTCTAAATTGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 12.40% | 0.34% | 0.06% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 61.80% | 37.00% | 1.06% | 0.13% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 86.30% | 12.60% | 0.78% | 0.26% | NA |
| Tropical Japonica | 504 | 35.90% | 62.90% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 37.80% | 60.60% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722226606 | C -> DEL | N | N | silent_mutation | Average:22.378; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0722226606 | C -> T | LOC_Os07g37090.1 | upstream_gene_variant ; 3270.0bp to feature; MODIFIER | silent_mutation | Average:22.378; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0722226606 | C -> T | LOC_Os07g37100.1 | downstream_gene_variant ; 4402.0bp to feature; MODIFIER | silent_mutation | Average:22.378; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0722226606 | C -> T | LOC_Os07g37100.2 | downstream_gene_variant ; 4402.0bp to feature; MODIFIER | silent_mutation | Average:22.378; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0722226606 | C -> T | LOC_Os07g37090-LOC_Os07g37100 | intergenic_region ; MODIFIER | silent_mutation | Average:22.378; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722226606 | NA | 7.22E-14 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0722226606 | NA | 5.46E-07 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722226606 | NA | 8.02E-07 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722226606 | NA | 5.88E-07 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722226606 | NA | 1.11E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722226606 | NA | 2.44E-09 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722226606 | NA | 1.83E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722226606 | NA | 2.01E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722226606 | NA | 7.39E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722226606 | NA | 3.33E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/