Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0722130735:

Variant ID: vg0722130735 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 22130735
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACCAACTCGTACGGGATGTGACACATCCTAGTACGATGAATCTAGACGGTACGAGATTGATTTATTTTGAGACGGAGGGAGTATGCTATTAAATCATA[T/C]
GGAGGACATATTCCAGCCATAAAAGACACGTCCCAAACAGATAGGCGATGCAAAATAGGCTTATTCTAGCACGATGGGCTGGTCGTGGTTTCGGGCCGGC

Reverse complement sequence

GCCGGCCCGAAACCACGACCAGCCCATCGTGCTAGAATAAGCCTATTTTGCATCGCCTATCTGTTTGGGACGTGTCTTTTATGGCTGGAATATGTCCTCC[A/G]
TATGATTTAATAGCATACTCCCTCCGTCTCAAAATAAATCAATCTCGTACCGTCTAGATTCATCGTACTAGGATGTGTCACATCCCGTACGAGTTGGTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.20%	38.70%	0.11%	0.00%	NA
All Indica	2759	89.60%	10.40%	0.07%	0.00%	NA
All Japonica	1512	6.90%	92.90%	0.20%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	86.00%	13.50%	0.43%	0.00%	NA
Indica III	913	86.60%	13.40%	0.00%	0.00%	NA
Indica Intermediate	786	88.00%	12.00%	0.00%	0.00%	NA
Temperate Japonica	767	1.60%	98.30%	0.13%	0.00%	NA
Tropical Japonica	504	14.50%	85.50%	0.00%	0.00%	NA
Japonica Intermediate	241	7.90%	91.30%	0.83%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722130735	T -> C	LOC_Os07g36970.1	upstream_gene_variant ; 902.0bp to feature; MODIFIER	silent_mutation	Average:96.614; most accessible tissue: Zhenshan97 panicle, score: 98.771	N	N	N	N
vg0722130735	T -> C	LOC_Os07g36950.1	downstream_gene_variant ; 2811.0bp to feature; MODIFIER	silent_mutation	Average:96.614; most accessible tissue: Zhenshan97 panicle, score: 98.771	N	N	N	N
vg0722130735	T -> C	LOC_Os07g36960.1	downstream_gene_variant ; 337.0bp to feature; MODIFIER	silent_mutation	Average:96.614; most accessible tissue: Zhenshan97 panicle, score: 98.771	N	N	N	N
vg0722130735	T -> C	LOC_Os07g36960.2	downstream_gene_variant ; 332.0bp to feature; MODIFIER	silent_mutation	Average:96.614; most accessible tissue: Zhenshan97 panicle, score: 98.771	N	N	N	N
vg0722130735	T -> C	LOC_Os07g36960-LOC_Os07g36970	intergenic_region ; MODIFIER	silent_mutation	Average:96.614; most accessible tissue: Zhenshan97 panicle, score: 98.771	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0722130735	T	C	0.02	0.01	0.01	0.02	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722130735	NA	4.75E-29	mr1256	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	NA	4.00E-39	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	NA	3.07E-37	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	NA	4.87E-24	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	NA	8.11E-06	mr1126_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	NA	5.92E-31	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	NA	3.45E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	1.58E-07	NA	mr1241_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	NA	5.79E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	NA	2.25E-28	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	NA	6.45E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	NA	4.15E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735	NA	8.43E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251