\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722130735:

Variant ID: vg0722130735 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22130735
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACCAACTCGTACGGGATGTGACACATCCTAGTACGATGAATCTAGACGGTACGAGATTGATTTATTTTGAGACGGAGGGAGTATGCTATTAAATCATA[T/C]
GGAGGACATATTCCAGCCATAAAAGACACGTCCCAAACAGATAGGCGATGCAAAATAGGCTTATTCTAGCACGATGGGCTGGTCGTGGTTTCGGGCCGGC

Reverse complement sequence

GCCGGCCCGAAACCACGACCAGCCCATCGTGCTAGAATAAGCCTATTTTGCATCGCCTATCTGTTTGGGACGTGTCTTTTATGGCTGGAATATGTCCTCC[A/G]
TATGATTTAATAGCATACTCCCTCCGTCTCAAAATAAATCAATCTCGTACCGTCTAGATTCATCGTACTAGGATGTGTCACATCCCGTACGAGTTGGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 38.70% 0.11% 0.00% NA
All Indica  2759 89.60% 10.40% 0.07% 0.00% NA
All Japonica  1512 6.90% 92.90% 0.20% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 86.00% 13.50% 0.43% 0.00% NA
Indica III  913 86.60% 13.40% 0.00% 0.00% NA
Indica Intermediate  786 88.00% 12.00% 0.00% 0.00% NA
Temperate Japonica  767 1.60% 98.30% 0.13% 0.00% NA
Tropical Japonica  504 14.50% 85.50% 0.00% 0.00% NA
Japonica Intermediate  241 7.90% 91.30% 0.83% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722130735 T -> C LOC_Os07g36970.1 upstream_gene_variant ; 902.0bp to feature; MODIFIER silent_mutation Average:96.614; most accessible tissue: Zhenshan97 panicle, score: 98.771 N N N N
vg0722130735 T -> C LOC_Os07g36950.1 downstream_gene_variant ; 2811.0bp to feature; MODIFIER silent_mutation Average:96.614; most accessible tissue: Zhenshan97 panicle, score: 98.771 N N N N
vg0722130735 T -> C LOC_Os07g36960.1 downstream_gene_variant ; 337.0bp to feature; MODIFIER silent_mutation Average:96.614; most accessible tissue: Zhenshan97 panicle, score: 98.771 N N N N
vg0722130735 T -> C LOC_Os07g36960.2 downstream_gene_variant ; 332.0bp to feature; MODIFIER silent_mutation Average:96.614; most accessible tissue: Zhenshan97 panicle, score: 98.771 N N N N
vg0722130735 T -> C LOC_Os07g36960-LOC_Os07g36970 intergenic_region ; MODIFIER silent_mutation Average:96.614; most accessible tissue: Zhenshan97 panicle, score: 98.771 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722130735 T C 0.02 0.01 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722130735 NA 4.75E-29 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 NA 4.00E-39 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 NA 3.07E-37 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 NA 4.87E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 NA 8.11E-06 mr1126_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 NA 5.92E-31 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 NA 3.45E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 1.58E-07 NA mr1241_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 NA 5.79E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 NA 2.25E-28 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 NA 6.45E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 NA 4.15E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722130735 NA 8.43E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251