\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722110531:

Variant ID: vg0722110531 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22110531
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGGATGAGAGGTGGAGCACGACGAGGTAGAGCATGGTGGAGTTGACGCGGAGGAAGCCGAGGGCGAAGGTGCCGGTGAGGGCAATTCTGTCTTATGAC[T/C]
CGACATTCTAGCGAAAATAATTTTGAAAACACACAAAGTGGTCAAAATGGAAAAAGTGACGGTGAATGCGCGTTAAATATGCTGAAGCGCGTTACATATT

Reverse complement sequence

AATATGTAACGCGCTTCAGCATATTTAACGCGCATTCACCGTCACTTTTTCCATTTTGACCACTTTGTGTGTTTTCAAAATTATTTTCGCTAGAATGTCG[A/G]
GTCATAAGACAGAATTGCCCTCACCGGCACCTTCGCCCTCGGCTTCCTCCGCGTCAACTCCACCATGCTCTACCTCGTCGTGCTCCACCTCTCATCCTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 32.60% 0.61% 0.00% NA
All Indica  2759 88.60% 10.40% 0.98% 0.00% NA
All Japonica  1512 26.20% 73.80% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.00% 1.50% 0.50% 0.00% NA
Indica II  465 86.00% 14.00% 0.00% 0.00% NA
Indica III  913 84.70% 13.00% 2.30% 0.00% NA
Indica Intermediate  786 87.50% 12.10% 0.38% 0.00% NA
Temperate Japonica  767 6.30% 93.70% 0.00% 0.00% NA
Tropical Japonica  504 50.80% 49.20% 0.00% 0.00% NA
Japonica Intermediate  241 38.20% 61.80% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 46.70% 51.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722110531 T -> C LOC_Os07g36930.1 upstream_gene_variant ; 256.0bp to feature; MODIFIER silent_mutation Average:81.825; most accessible tissue: Callus, score: 96.198 N N N N
vg0722110531 T -> C LOC_Os07g36940.1 upstream_gene_variant ; 4430.0bp to feature; MODIFIER silent_mutation Average:81.825; most accessible tissue: Callus, score: 96.198 N N N N
vg0722110531 T -> C LOC_Os07g36940.2 upstream_gene_variant ; 4430.0bp to feature; MODIFIER silent_mutation Average:81.825; most accessible tissue: Callus, score: 96.198 N N N N
vg0722110531 T -> C LOC_Os07g36920.1 downstream_gene_variant ; 395.0bp to feature; MODIFIER silent_mutation Average:81.825; most accessible tissue: Callus, score: 96.198 N N N N
vg0722110531 T -> C LOC_Os07g36920-LOC_Os07g36930 intergenic_region ; MODIFIER silent_mutation Average:81.825; most accessible tissue: Callus, score: 96.198 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722110531 T C 0.0 -0.01 -0.02 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722110531 NA 2.57E-19 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722110531 NA 5.59E-11 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 4.07E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 3.32E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 6.65E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 1.44E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 5.68E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 8.18E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 8.96E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 6.41E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 7.28E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 4.88E-11 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 1.34E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 5.80E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 1.66E-08 mr1780 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 5.94E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 5.96E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 2.79E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 1.71E-14 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 6.95E-08 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 2.76E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 1.38E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 9.20E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 5.57E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 2.41E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 1.15E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 4.57E-08 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722110531 NA 3.40E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251