\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722086783:

Variant ID: vg0722086783 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22086783
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TATACTTATCAGCTAAAATTTTAATTTTCAACATTAAATTTAAAGCTAATTATAGGGTTTTTTCATTGAAGCCTATTTTTTAGCCTTTGCTTTTAGATTA[T/C]
TAAGAATACGTATATAAAAGTTTTATTACAAATTACTTTTCGTTTACAAATATGCTGTCTAGCTTGTTCCTTGAATAAGCGAAACAATGGAGCCGTTACT

Reverse complement sequence

AGTAACGGCTCCATTGTTTCGCTTATTCAAGGAACAAGCTAGACAGCATATTTGTAAACGAAAAGTAATTTGTAATAAAACTTTTATATACGTATTCTTA[A/G]
TAATCTAAAAGCAAAGGCTAAAAAATAGGCTTCAATGAAAAAACCCTATAATTAGCTTTAAATTTAATGTTGAAAATTAAAATTTTAGCTGATAAGTATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 32.50% 0.04% 0.00% NA
All Indica  2759 89.90% 10.10% 0.04% 0.00% NA
All Japonica  1512 25.80% 74.10% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 86.00% 13.80% 0.22% 0.00% NA
Indica III  913 88.10% 11.90% 0.00% 0.00% NA
Indica Intermediate  786 88.00% 12.00% 0.00% 0.00% NA
Temperate Japonica  767 6.30% 93.70% 0.00% 0.00% NA
Tropical Japonica  504 50.40% 49.60% 0.00% 0.00% NA
Japonica Intermediate  241 36.50% 63.10% 0.41% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722086783 T -> C LOC_Os07g36880.1 upstream_gene_variant ; 1217.0bp to feature; MODIFIER silent_mutation Average:62.723; most accessible tissue: Callus, score: 93.981 N N N N
vg0722086783 T -> C LOC_Os07g36870.1 downstream_gene_variant ; 325.0bp to feature; MODIFIER silent_mutation Average:62.723; most accessible tissue: Callus, score: 93.981 N N N N
vg0722086783 T -> C LOC_Os07g36890.1 downstream_gene_variant ; 4141.0bp to feature; MODIFIER silent_mutation Average:62.723; most accessible tissue: Callus, score: 93.981 N N N N
vg0722086783 T -> C LOC_Os07g36870-LOC_Os07g36880 intergenic_region ; MODIFIER silent_mutation Average:62.723; most accessible tissue: Callus, score: 93.981 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722086783 NA 1.71E-19 Grain_length Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722086783 NA 7.94E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 1.73E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 1.31E-11 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 2.06E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 6.82E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 1.46E-07 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 3.14E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 3.15E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 1.36E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 6.08E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 1.57E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 4.08E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 2.16E-10 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 5.56E-08 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783 NA 6.08E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251