\
| Variant ID: vg0722086783 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22086783 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 232. )
TATACTTATCAGCTAAAATTTTAATTTTCAACATTAAATTTAAAGCTAATTATAGGGTTTTTTCATTGAAGCCTATTTTTTAGCCTTTGCTTTTAGATTA[T/C]
TAAGAATACGTATATAAAAGTTTTATTACAAATTACTTTTCGTTTACAAATATGCTGTCTAGCTTGTTCCTTGAATAAGCGAAACAATGGAGCCGTTACT
AGTAACGGCTCCATTGTTTCGCTTATTCAAGGAACAAGCTAGACAGCATATTTGTAAACGAAAAGTAATTTGTAATAAAACTTTTATATACGTATTCTTA[A/G]
TAATCTAAAAGCAAAGGCTAAAAAATAGGCTTCAATGAAAAAACCCTATAATTAGCTTTAAATTTAATGTTGAAAATTAAAATTTTAGCTGATAAGTATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.40% | 32.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 89.90% | 10.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 25.80% | 74.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.00% | 13.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 50.40% | 49.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.50% | 63.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722086783 | T -> C | LOC_Os07g36880.1 | upstream_gene_variant ; 1217.0bp to feature; MODIFIER | silent_mutation | Average:62.723; most accessible tissue: Callus, score: 93.981 | N | N | N | N |
| vg0722086783 | T -> C | LOC_Os07g36870.1 | downstream_gene_variant ; 325.0bp to feature; MODIFIER | silent_mutation | Average:62.723; most accessible tissue: Callus, score: 93.981 | N | N | N | N |
| vg0722086783 | T -> C | LOC_Os07g36890.1 | downstream_gene_variant ; 4141.0bp to feature; MODIFIER | silent_mutation | Average:62.723; most accessible tissue: Callus, score: 93.981 | N | N | N | N |
| vg0722086783 | T -> C | LOC_Os07g36870-LOC_Os07g36880 | intergenic_region ; MODIFIER | silent_mutation | Average:62.723; most accessible tissue: Callus, score: 93.981 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722086783 | NA | 1.71E-19 | Grain_length | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0722086783 | NA | 7.94E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 1.73E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 1.31E-11 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 2.06E-07 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 6.82E-08 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 1.46E-07 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 3.14E-06 | mr1858 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 3.15E-06 | mr1859 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 1.36E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 6.08E-07 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 1.57E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 4.08E-12 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 2.16E-10 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 5.56E-08 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722086783 | NA | 6.08E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |