Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722032999:

Variant ID: vg0722032999 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 22032999
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

AAACATGCCTTCCCGAGCAAGGAAACCCGAGACCCGACGAAAACAGACTTGGACTCGGACCCTGCCTGTCAGACCGCCCATATACCTGCGGTCAGACCGG[T/C]
CCTACTAGCTGGTCAGACCGCCCACACACCTGTGGTCTGACCGGCCCTGTGAAGGAAATCTGTCACTTTCCAAACTTTGGCAATCTTCCCCTATTTCGTC

Reverse complement sequence

GACGAAATAGGGGAAGATTGCCAAAGTTTGGAAAGTGACAGATTTCCTTCACAGGGCCGGTCAGACCACAGGTGTGTGGGCGGTCTGACCAGCTAGTAGG[A/G]
CCGGTCTGACCGCAGGTATATGGGCGGTCTGACAGGCAGGGTCCGAGTCCAAGTCTGTTTTCGTCGGGTCTCGGGTTTCCTTGCTCGGGAAGGCATGTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	34.80%	0.08%	5.67%	NA
All Indica	2759	87.30%	12.50%	0.07%	0.11%	NA
All Japonica	1512	6.10%	76.50%	0.07%	17.33%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.20%	1.50%	0.34%	0.00%	NA
Indica II	465	78.70%	21.10%	0.00%	0.22%	NA
Indica III	913	87.20%	12.60%	0.00%	0.22%	NA
Indica Intermediate	786	84.20%	15.80%	0.00%	0.00%	NA
Temperate Japonica	767	0.40%	95.20%	0.13%	4.30%	NA
Tropical Japonica	504	13.90%	54.20%	0.00%	31.94%	NA
Japonica Intermediate	241	7.90%	63.90%	0.00%	28.22%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	45.60%	50.00%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722032999	T -> DEL	N	N	silent_mutation	Average:54.078; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0722032999	T -> C	LOC_Os07g36780.1	downstream_gene_variant ; 3909.0bp to feature; MODIFIER	silent_mutation	Average:54.078; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0722032999	T -> C	LOC_Os07g36770.1	intron_variant ; MODIFIER	silent_mutation	Average:54.078; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722032999	NA	8.80E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	1.84E-06	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	NA	8.67E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	NA	5.12E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	NA	2.49E-12	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	NA	4.08E-24	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	2.58E-06	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	3.60E-06	NA	mr1088_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	4.34E-08	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	1.61E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	9.80E-07	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	NA	2.95E-30	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	NA	1.15E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	9.27E-07	NA	mr1224_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	9.12E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	NA	4.67E-26	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	1.23E-06	NA	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	1.08E-06	NA	mr1246_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	8.17E-07	NA	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	9.55E-08	NA	mr1404_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	4.36E-06	NA	mr1437_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	NA	2.68E-28	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	6.17E-07	NA	mr1620_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	2.41E-06	7.64E-25	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999	NA	5.87E-08	mr1949_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251