\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722032999:

Variant ID: vg0722032999 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22032999
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


AAACATGCCTTCCCGAGCAAGGAAACCCGAGACCCGACGAAAACAGACTTGGACTCGGACCCTGCCTGTCAGACCGCCCATATACCTGCGGTCAGACCGG[T/C]
CCTACTAGCTGGTCAGACCGCCCACACACCTGTGGTCTGACCGGCCCTGTGAAGGAAATCTGTCACTTTCCAAACTTTGGCAATCTTCCCCTATTTCGTC

Reverse complement sequence

GACGAAATAGGGGAAGATTGCCAAAGTTTGGAAAGTGACAGATTTCCTTCACAGGGCCGGTCAGACCACAGGTGTGTGGGCGGTCTGACCAGCTAGTAGG[A/G]
CCGGTCTGACCGCAGGTATATGGGCGGTCTGACAGGCAGGGTCCGAGTCCAAGTCTGTTTTCGTCGGGTCTCGGGTTTCCTTGCTCGGGAAGGCATGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 34.80% 0.08% 5.67% NA
All Indica  2759 87.30% 12.50% 0.07% 0.11% NA
All Japonica  1512 6.10% 76.50% 0.07% 17.33% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.20% 1.50% 0.34% 0.00% NA
Indica II  465 78.70% 21.10% 0.00% 0.22% NA
Indica III  913 87.20% 12.60% 0.00% 0.22% NA
Indica Intermediate  786 84.20% 15.80% 0.00% 0.00% NA
Temperate Japonica  767 0.40% 95.20% 0.13% 4.30% NA
Tropical Japonica  504 13.90% 54.20% 0.00% 31.94% NA
Japonica Intermediate  241 7.90% 63.90% 0.00% 28.22% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 45.60% 50.00% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722032999 T -> DEL N N silent_mutation Average:54.078; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0722032999 T -> C LOC_Os07g36780.1 downstream_gene_variant ; 3909.0bp to feature; MODIFIER silent_mutation Average:54.078; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0722032999 T -> C LOC_Os07g36770.1 intron_variant ; MODIFIER silent_mutation Average:54.078; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722032999 NA 8.80E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 1.84E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 NA 8.67E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 NA 5.12E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 NA 2.49E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 NA 4.08E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 2.58E-06 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 3.60E-06 NA mr1088_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 4.34E-08 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 1.61E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 9.80E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 NA 2.95E-30 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 NA 1.15E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 9.27E-07 NA mr1224_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 9.12E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 NA 4.67E-26 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 1.23E-06 NA mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 1.08E-06 NA mr1246_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 8.17E-07 NA mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 9.55E-08 NA mr1404_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 4.36E-06 NA mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 NA 2.68E-28 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 6.17E-07 NA mr1620_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 2.41E-06 7.64E-25 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722032999 NA 5.87E-08 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251