\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722002330:

Variant ID: vg0722002330 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22002330
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


AATATCTCAGATTCTCTGTAAGGACTCCTCTGGTTGAGTAATATATCTTTGCTCTTCCCCTCAAAAAAAAACAAACGAACTTAAAATTTGACTCATACAC[G/A]
GAATTATATTTTCAAAAGCTAACGAACTAAAAAACCAACTCAAACACGGATGAGACGTACCAAAATACCGGCAAAAACTTCTTCAACTTTTATAATAGTA

Reverse complement sequence

TACTATTATAAAAGTTGAAGAAGTTTTTGCCGGTATTTTGGTACGTCTCATCCGTGTTTGAGTTGGTTTTTTAGTTCGTTAGCTTTTGAAAATATAATTC[C/T]
GTGTATGAGTCAAATTTTAAGTTCGTTTGTTTTTTTTTGAGGGGAAGAGCAAAGATATATTACTCAACCAGAGGAGTCCTTACAGAGAATCTGAGATATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 36.00% 0.02% 0.00% NA
All Indica  2759 55.60% 44.30% 0.04% 0.00% NA
All Japonica  1512 82.10% 17.90% 0.00% 0.00% NA
Aus  269 30.50% 69.50% 0.00% 0.00% NA
Indica I  595 85.40% 14.60% 0.00% 0.00% NA
Indica II  465 53.80% 46.20% 0.00% 0.00% NA
Indica III  913 38.80% 61.10% 0.11% 0.00% NA
Indica Intermediate  786 53.80% 46.20% 0.00% 0.00% NA
Temperate Japonica  767 95.00% 5.00% 0.00% 0.00% NA
Tropical Japonica  504 67.70% 32.30% 0.00% 0.00% NA
Japonica Intermediate  241 71.00% 29.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722002330 G -> A LOC_Os07g36720.1 downstream_gene_variant ; 64.0bp to feature; MODIFIER silent_mutation Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0722002330 G -> A LOC_Os07g36730.1 downstream_gene_variant ; 706.0bp to feature; MODIFIER silent_mutation Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0722002330 G -> A LOC_Os07g36740.1 downstream_gene_variant ; 3732.0bp to feature; MODIFIER silent_mutation Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0722002330 G -> A LOC_Os07g36720-LOC_Os07g36730 intergenic_region ; MODIFIER silent_mutation Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722002330 NA 1.71E-06 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722002330 7.75E-06 NA mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330 NA 1.90E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330 NA 6.37E-08 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330 NA 7.67E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330 NA 2.37E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330 NA 4.00E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330 NA 1.86E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330 9.71E-06 NA mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330 4.66E-06 1.51E-06 mr1520 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330 NA 5.16E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330 NA 1.54E-07 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251