\
| Variant ID: vg0722002330 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22002330 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 168. )
AATATCTCAGATTCTCTGTAAGGACTCCTCTGGTTGAGTAATATATCTTTGCTCTTCCCCTCAAAAAAAAACAAACGAACTTAAAATTTGACTCATACAC[G/A]
GAATTATATTTTCAAAAGCTAACGAACTAAAAAACCAACTCAAACACGGATGAGACGTACCAAAATACCGGCAAAAACTTCTTCAACTTTTATAATAGTA
TACTATTATAAAAGTTGAAGAAGTTTTTGCCGGTATTTTGGTACGTCTCATCCGTGTTTGAGTTGGTTTTTTAGTTCGTTAGCTTTTGAAAATATAATTC[C/T]
GTGTATGAGTCAAATTTTAAGTTCGTTTGTTTTTTTTTGAGGGGAAGAGCAAAGATATATTACTCAACCAGAGGAGTCCTTACAGAGAATCTGAGATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 36.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 55.60% | 44.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 82.10% | 17.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 30.50% | 69.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 53.80% | 46.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 38.80% | 61.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 53.80% | 46.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722002330 | G -> A | LOC_Os07g36720.1 | downstream_gene_variant ; 64.0bp to feature; MODIFIER | silent_mutation | Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0722002330 | G -> A | LOC_Os07g36730.1 | downstream_gene_variant ; 706.0bp to feature; MODIFIER | silent_mutation | Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0722002330 | G -> A | LOC_Os07g36740.1 | downstream_gene_variant ; 3732.0bp to feature; MODIFIER | silent_mutation | Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0722002330 | G -> A | LOC_Os07g36720-LOC_Os07g36730 | intergenic_region ; MODIFIER | silent_mutation | Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722002330 | NA | 1.71E-06 | Grain_weight | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0722002330 | 7.75E-06 | NA | mr1139 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722002330 | NA | 1.90E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722002330 | NA | 6.37E-08 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722002330 | NA | 7.67E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722002330 | NA | 2.37E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722002330 | NA | 4.00E-06 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722002330 | NA | 1.86E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722002330 | 9.71E-06 | NA | mr1437 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722002330 | 4.66E-06 | 1.51E-06 | mr1520 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722002330 | NA | 5.16E-09 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722002330 | NA | 1.54E-07 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |