\
| Variant ID: vg0721979371 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21979371 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCGTCGGTTGTATTCTCGGGCTGTCTGAGCTGCAACCTAAGTTAAGGTAAATAAGTCCTCTATTTATTTTAAGGATTGTTATGATTCATATTTGTCACC[G/A]
TGGGTACCAGCACTATGTCCTGGGACTGGTACCGAGATCGCGGTTTCGTAGGAAGCGGTTCGCGCCGCTTTCCCTACGACACGCTCCTGTCAGGTGCCGT
ACGGCACCTGACAGGAGCGTGTCGTAGGGAAAGCGGCGCGAACCGCTTCCTACGAAACCGCGATCTCGGTACCAGTCCCAGGACATAGTGCTGGTACCCA[C/T]
GGTGACAAATATGAATCATAACAATCCTTAAAATAAATAGAGGACTTATTTACCTTAACTTAGGTTGCAGCTCAGACAGCCCGAGAATACAACCGACGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.60% | 4.90% | 22.05% | 31.46% | NA |
| All Indica | 2759 | 16.70% | 0.30% | 31.24% | 51.83% | NA |
| All Japonica | 1512 | 83.70% | 14.40% | 1.19% | 0.66% | NA |
| Aus | 269 | 56.90% | 0.00% | 40.15% | 2.97% | NA |
| Indica I | 595 | 4.40% | 0.20% | 13.11% | 82.35% | NA |
| Indica II | 465 | 21.10% | 0.20% | 29.25% | 49.46% | NA |
| Indica III | 913 | 17.70% | 0.40% | 45.02% | 36.80% | NA |
| Indica Intermediate | 786 | 22.10% | 0.10% | 30.15% | 47.58% | NA |
| Temperate Japonica | 767 | 94.80% | 3.90% | 0.26% | 1.04% | NA |
| Tropical Japonica | 504 | 70.00% | 28.60% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 18.30% | 3.73% | 0.83% | NA |
| VI/Aromatic | 96 | 41.70% | 0.00% | 34.38% | 23.96% | NA |
| Intermediate | 90 | 51.10% | 7.80% | 23.33% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721979371 | G -> DEL | N | N | silent_mutation | Average:11.839; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg0721979371 | G -> A | LOC_Os07g36690-LOC_Os07g36700 | intergenic_region ; MODIFIER | silent_mutation | Average:11.839; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721979371 | NA | 4.30E-06 | mr1086 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | NA | 2.51E-08 | mr1104 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | NA | 9.07E-06 | mr1139 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | 3.61E-06 | 9.65E-08 | mr1155 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | NA | 1.66E-09 | mr1213 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | NA | 5.00E-08 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | NA | 3.33E-07 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | 2.35E-07 | 8.68E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | NA | 7.86E-06 | mr1246 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | NA | 8.48E-07 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | 6.13E-06 | 1.27E-08 | mr1437 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | NA | 1.09E-07 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | NA | 7.58E-07 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | NA | 1.92E-06 | mr1790 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721979371 | 2.51E-06 | 3.29E-06 | mr1878 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |