\
| Variant ID: vg0721964052 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21964052 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGAAGCACCTTCATAGTTATCACAAGTGCATATTTGTGCTTGGACAATTAATCCGCTCTACGCGTGTAGGATGTGAATAATGTCCCTAACACATGGTCCC[A/G]
ATGATTGTAGCATTGGAGAAACGGACGTCCGAGCAATGCACCTTTACGTATAAGTAAATAATGAATATTTTGGGAGTTCATTAATTATTTTAAACTACAT
ATGTAGTTTAAAATAATTAATGAACTCCCAAAATATTCATTATTTACTTATACGTAAAGGTGCATTGCTCGGACGTCCGTTTCTCCAATGCTACAATCAT[T/C]
GGGACCATGTGTTAGGGACATTATTCACATCCTACACGCGTAGAGCGGATTAATTGTCCAAGCACAAATATGCACTTGTGATAACTATGAAGGTGCTTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.10% | 39.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 88.50% | 11.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.00% | 13.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.20% | 99.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 67.70% | 31.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721964052 | A -> G | LOC_Os07g36680-LOC_Os07g36690 | intergenic_region ; MODIFIER | silent_mutation | Average:36.616; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721964052 | NA | 7.91E-16 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721964052 | NA | 4.34E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721964052 | NA | 1.07E-12 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721964052 | NA | 7.24E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721964052 | NA | 3.19E-08 | mr1439 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721964052 | NA | 2.03E-10 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721964052 | NA | 1.82E-09 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721964052 | NA | 2.43E-16 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721964052 | NA | 1.79E-07 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |