\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721855491:

Variant ID: vg0721855491 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21855491
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAAAACCTTAATAACATATTAATAACATAGATTAATATAAAATATATCACTCTACAAACATATATAACTAAATTCAACTTCTTCAAGTCGTAAAAAAA[C/T]
AAATTTAACTAAAAATATCGTGCATTCGCAGTTATATGGCCCTGTTCGACTGCCCTTATTTATACTATGTTGCAGCCTATATGCATAGTATTTTATATGT

Reverse complement sequence

ACATATAAAATACTATGCATATAGGCTGCAACATAGTATAAATAAGGGCAGTCGAACAGGGCCATATAACTGCGAATGCACGATATTTTTAGTTAAATTT[G/A]
TTTTTTTACGACTTGAAGAAGTTGAATTTAGTTATATATGTTTGTAGAGTGATATATTTTATATTAATCTATGTTATTAATATGTTATTAAGGTTTTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 7.00% 7.09% 0.00% NA
All Indica  2759 79.10% 10.40% 10.47% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 70.30% 15.20% 14.50% 0.00% NA
Indica I  595 90.80% 5.40% 3.87% 0.00% NA
Indica II  465 90.30% 2.60% 7.10% 0.00% NA
Indica III  913 63.30% 18.60% 18.07% 0.00% NA
Indica Intermediate  786 82.10% 9.30% 8.65% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 1.10% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721855491 C -> T LOC_Os07g36544.2 upstream_gene_variant ; 4194.0bp to feature; MODIFIER silent_mutation Average:56.086; most accessible tissue: Callus, score: 81.131 N N N N
vg0721855491 C -> T LOC_Os07g36544.1 upstream_gene_variant ; 4194.0bp to feature; MODIFIER silent_mutation Average:56.086; most accessible tissue: Callus, score: 81.131 N N N N
vg0721855491 C -> T LOC_Os07g36560.1 intron_variant ; MODIFIER silent_mutation Average:56.086; most accessible tissue: Callus, score: 81.131 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721855491 NA 8.05E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721855491 NA 4.03E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721855491 NA 7.44E-06 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721855491 NA 9.95E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721855491 NA 1.53E-06 mr1291_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721855491 NA 7.50E-06 mr1477_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721855491 9.09E-06 1.09E-06 mr1642_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251