\
| Variant ID: vg0721855491 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21855491 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTAAAAACCTTAATAACATATTAATAACATAGATTAATATAAAATATATCACTCTACAAACATATATAACTAAATTCAACTTCTTCAAGTCGTAAAAAAA[C/T]
AAATTTAACTAAAAATATCGTGCATTCGCAGTTATATGGCCCTGTTCGACTGCCCTTATTTATACTATGTTGCAGCCTATATGCATAGTATTTTATATGT
ACATATAAAATACTATGCATATAGGCTGCAACATAGTATAAATAAGGGCAGTCGAACAGGGCCATATAACTGCGAATGCACGATATTTTTAGTTAAATTT[G/A]
TTTTTTTACGACTTGAAGAAGTTGAATTTAGTTATATATGTTTGTAGAGTGATATATTTTATATTAATCTATGTTATTAATATGTTATTAAGGTTTTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 7.00% | 7.09% | 0.00% | NA |
| All Indica | 2759 | 79.10% | 10.40% | 10.47% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 70.30% | 15.20% | 14.50% | 0.00% | NA |
| Indica I | 595 | 90.80% | 5.40% | 3.87% | 0.00% | NA |
| Indica II | 465 | 90.30% | 2.60% | 7.10% | 0.00% | NA |
| Indica III | 913 | 63.30% | 18.60% | 18.07% | 0.00% | NA |
| Indica Intermediate | 786 | 82.10% | 9.30% | 8.65% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 1.10% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721855491 | C -> T | LOC_Os07g36544.2 | upstream_gene_variant ; 4194.0bp to feature; MODIFIER | silent_mutation | Average:56.086; most accessible tissue: Callus, score: 81.131 | N | N | N | N |
| vg0721855491 | C -> T | LOC_Os07g36544.1 | upstream_gene_variant ; 4194.0bp to feature; MODIFIER | silent_mutation | Average:56.086; most accessible tissue: Callus, score: 81.131 | N | N | N | N |
| vg0721855491 | C -> T | LOC_Os07g36560.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.086; most accessible tissue: Callus, score: 81.131 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721855491 | NA | 8.05E-06 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721855491 | NA | 4.03E-06 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721855491 | NA | 7.44E-06 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721855491 | NA | 9.95E-06 | mr1181_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721855491 | NA | 1.53E-06 | mr1291_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721855491 | NA | 7.50E-06 | mr1477_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721855491 | 9.09E-06 | 1.09E-06 | mr1642_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |