Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721832137:

Variant ID: vg0721832137 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21832137
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

TCTAGTTAATGGATGCCGTTCCATGTACACTCCGTTCAACGACGACGCATGGGAGAAGATACGCGACAGGCCCGGTCCTGTCAATTTAGTGGCCCAGAGC[G/A]
AAGCTAGAAAAATAGGCTCTTTAATACAACTATAATATATAACGATGTTTCTGATAAATATAATGCATAAAATACATTTAAGTTATATATATTACCTTAA

Reverse complement sequence

TTAAGGTAATATATATAACTTAAATGTATTTTATGCATTATATTTATCAGAAACATCGTTATATATTATAGTTGTATTAAAGAGCCTATTTTTCTAGCTT[C/T]
GCTCTGGGCCACTAAATTGACAGGACCGGGCCTGTCGCGTATCTTCTCCCATGCGTCGTCGTTGAACGGAGTGTACATGGAACGGCATCCATTAACTAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.10%	11.60%	0.28%	0.00%	NA
All Indica	2759	80.00%	19.50%	0.43%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	98.80%	0.70%	0.50%	0.00%	NA
Indica II	465	58.50%	40.40%	1.08%	0.00%	NA
Indica III	913	77.40%	22.60%	0.00%	0.00%	NA
Indica Intermediate	786	81.60%	17.90%	0.51%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721832137	G -> A	LOC_Os07g36510.1	upstream_gene_variant ; 1159.0bp to feature; MODIFIER	silent_mutation	Average:55.311; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0721832137	G -> A	LOC_Os07g36520.1	upstream_gene_variant ; 4857.0bp to feature; MODIFIER	silent_mutation	Average:55.311; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0721832137	G -> A	LOC_Os07g36500.1	downstream_gene_variant ; 4270.0bp to feature; MODIFIER	silent_mutation	Average:55.311; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0721832137	G -> A	LOC_Os07g36510-LOC_Os07g36520	intergenic_region ; MODIFIER	silent_mutation	Average:55.311; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721832137	NA	1.72E-06	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721832137	NA	2.98E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721832137	NA	3.50E-06	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721832137	NA	5.95E-10	mr1974	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721832137	NA	8.05E-08	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721832137	NA	2.10E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721832137	NA	2.70E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251