\
| Variant ID: vg0721832137 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21832137 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 116. )
TCTAGTTAATGGATGCCGTTCCATGTACACTCCGTTCAACGACGACGCATGGGAGAAGATACGCGACAGGCCCGGTCCTGTCAATTTAGTGGCCCAGAGC[G/A]
AAGCTAGAAAAATAGGCTCTTTAATACAACTATAATATATAACGATGTTTCTGATAAATATAATGCATAAAATACATTTAAGTTATATATATTACCTTAA
TTAAGGTAATATATATAACTTAAATGTATTTTATGCATTATATTTATCAGAAACATCGTTATATATTATAGTTGTATTAAAGAGCCTATTTTTCTAGCTT[C/T]
GCTCTGGGCCACTAAATTGACAGGACCGGGCCTGTCGCGTATCTTCTCCCATGCGTCGTCGTTGAACGGAGTGTACATGGAACGGCATCCATTAACTAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.10% | 11.60% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 80.00% | 19.50% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 58.50% | 40.40% | 1.08% | 0.00% | NA |
| Indica III | 913 | 77.40% | 22.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.60% | 17.90% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721832137 | G -> A | LOC_Os07g36510.1 | upstream_gene_variant ; 1159.0bp to feature; MODIFIER | silent_mutation | Average:55.311; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0721832137 | G -> A | LOC_Os07g36520.1 | upstream_gene_variant ; 4857.0bp to feature; MODIFIER | silent_mutation | Average:55.311; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0721832137 | G -> A | LOC_Os07g36500.1 | downstream_gene_variant ; 4270.0bp to feature; MODIFIER | silent_mutation | Average:55.311; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0721832137 | G -> A | LOC_Os07g36510-LOC_Os07g36520 | intergenic_region ; MODIFIER | silent_mutation | Average:55.311; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721832137 | NA | 1.72E-06 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721832137 | NA | 2.98E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721832137 | NA | 3.50E-06 | mr1958 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721832137 | NA | 5.95E-10 | mr1974 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721832137 | NA | 8.05E-08 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721832137 | NA | 2.10E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721832137 | NA | 2.70E-07 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |