\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721760138:

Variant ID: vg0721760138 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21760138
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGTAATTTTCTCTTCTTCTTGCTTTCCTAGCCTTTGACTATTTGTATTTAACCCTCTTCTATCTATCGATATAAGGCCAATCAATTTTGATCGGCCGTT[C/T]
CAAAAAAATTAAGGCCGAGTTTAGTTTTAAATTTTTTTTATCAAACTTTCAACTTTTCCATCACATTAAAATTTTTCTACACACATAAACTTTTAATTTT

Reverse complement sequence

AAAATTAAAAGTTTATGTGTGTAGAAAAATTTTAATGTGATGGAAAAGTTGAAAGTTTGATAAAAAAAATTTAAAACTAAACTCGGCCTTAATTTTTTTG[G/A]
AACGGCCGATCAAAATTGATTGGCCTTATATCGATAGATAGAAGAGGGTTAAATACAAATAGTCAAAGGCTAGGAAAGCAAGAAGAAGAGAAAATTACTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.90% 1.10% 1.02% 0.00% NA
All Indica  2759 96.70% 1.70% 1.63% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 98.10% 0.70% 1.12% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 97.00% 0.40% 2.58% 0.00% NA
Indica III  913 93.20% 4.20% 2.63% 0.00% NA
Indica Intermediate  786 98.30% 0.80% 0.89% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721760138 C -> T LOC_Os07g36400.1 upstream_gene_variant ; 467.0bp to feature; MODIFIER silent_mutation Average:83.793; most accessible tissue: Zhenshan97 flag leaf, score: 90.522 N N N N
vg0721760138 C -> T LOC_Os07g36390.1 downstream_gene_variant ; 2816.0bp to feature; MODIFIER silent_mutation Average:83.793; most accessible tissue: Zhenshan97 flag leaf, score: 90.522 N N N N
vg0721760138 C -> T LOC_Os07g36390-LOC_Os07g36400 intergenic_region ; MODIFIER silent_mutation Average:83.793; most accessible tissue: Zhenshan97 flag leaf, score: 90.522 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721760138 C T 0.01 0.02 0.03 0.0 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721760138 NA 7.80E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721760138 NA 8.51E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721760138 NA 2.20E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721760138 NA 3.77E-18 mr1324_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721760138 NA 4.97E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721760138 NA 9.20E-18 mr1333_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721760138 NA 5.29E-06 mr1333_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721760138 NA 1.89E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721760138 NA 4.70E-23 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721760138 NA 7.24E-09 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721760138 4.91E-06 NA mr1642_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721760138 NA 5.38E-18 mr1686_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251