\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721621489:

Variant ID: vg0721621489 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21621489
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGAGCCCACCCTACAATCTACACCGTTGGATCGATCAACACGCTCCTCCCCGCCGCGAGCTCCGCTTATCTCAATTCTCCGCCGTTGTGCTGCTCACC[C/T]
CCACCGAGGAGTGCGGCCATGGCGGGAGCCTTCTCCCTCCGCCTGGGACCGCGCATCGCGGGGACGCCACCGCCGCCGGCGAGCGCGACGAAGGGCGAGG

Reverse complement sequence

CCTCGCCCTTCGTCGCGCTCGCCGGCGGCGGTGGCGTCCCCGCGATGCGCGGTCCCAGGCGGAGGGAGAAGGCTCCCGCCATGGCCGCACTCCTCGGTGG[G/A]
GGTGAGCAGCACAACGGCGGAGAATTGAGATAAGCGGAGCTCGCGGCGGGGAGGAGCGTGTTGATCGATCCAACGGTGTAGATTGTAGGGTGGGCTCATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 34.90% 0.11% 0.00% NA
All Indica  2759 90.80% 9.00% 0.14% 0.00% NA
All Japonica  1512 17.00% 82.90% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.00% 0.80% 0.17% 0.00% NA
Indica II  465 92.50% 7.30% 0.22% 0.00% NA
Indica III  913 85.00% 14.90% 0.11% 0.00% NA
Indica Intermediate  786 90.50% 9.40% 0.13% 0.00% NA
Temperate Japonica  767 30.90% 69.00% 0.13% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721621489 C -> T LOC_Os07g36180.2 5_prime_UTR_variant ; 19.0bp to feature; MODIFIER silent_mutation Average:97.94; most accessible tissue: Zhenshan97 flag leaf, score: 99.261 N N N N
vg0721621489 C -> T LOC_Os07g36180.1 5_prime_UTR_variant ; 19.0bp to feature; MODIFIER silent_mutation Average:97.94; most accessible tissue: Zhenshan97 flag leaf, score: 99.261 N N N N
vg0721621489 C -> T LOC_Os07g36190.1 upstream_gene_variant ; 4130.0bp to feature; MODIFIER silent_mutation Average:97.94; most accessible tissue: Zhenshan97 flag leaf, score: 99.261 N N N N
vg0721621489 C -> T LOC_Os07g36170.1 downstream_gene_variant ; 1162.0bp to feature; MODIFIER silent_mutation Average:97.94; most accessible tissue: Zhenshan97 flag leaf, score: 99.261 N N N N
vg0721621489 C -> T LOC_Os07g36170.2 downstream_gene_variant ; 1173.0bp to feature; MODIFIER silent_mutation Average:97.94; most accessible tissue: Zhenshan97 flag leaf, score: 99.261 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721621489 C T -0.05 -0.05 -0.04 -0.05 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721621489 NA 2.49E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 2.07E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 3.51E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 3.82E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 2.26E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 8.44E-07 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 1.24E-27 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 5.70E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 1.50E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 7.97E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 1.63E-18 mr1148_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 1.59E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 6.23E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 1.55E-22 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 2.83E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 1.01E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721621489 NA 1.44E-14 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251