Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0721581927:

Variant ID: vg0721581927 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21581927
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 118. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTAAACTACCAACTTTCTCTAAATTTCTTCTTAATTTCGCGTCGTCATGTGATTCCTTTTCTACATTTTCTTTCCTAAGCACCCGCGGAAAAAAA[A/T]
AGAGAAAGGTTATCCTAGGTATCAAAGGGGCCTAACCCAAATTAGATTTCGCGACTTTATATCGGCAATGTTACCCTCAATGCAATTAGCGCGTAAATCA

Reverse complement sequence

TGATTTACGCGCTAATTGCATTGAGGGTAACATTGCCGATATAAAGTCGCGAAATCTAATTTGGGTTAGGCCCCTTTGATACCTAGGATAACCTTTCTCT[T/A]
TTTTTTTCCGCGGGTGCTTAGGAAAGAAAATGTAGAAAAGGAATCACATGACGACGCGAAATTAAGAAGAAATTTAGAGAAAGTTGGTAGTTTAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 0.60% 16.23% 5.06% NA
All Indica  2759 66.00% 0.00% 25.44% 8.55% NA
All Japonica  1512 97.20% 1.80% 1.06% 0.00% NA
Aus  269 84.40% 0.00% 14.87% 0.74% NA
Indica I  595 27.20% 0.00% 61.18% 11.60% NA
Indica II  465 80.90% 0.00% 13.98% 5.16% NA
Indica III  913 81.90% 0.00% 9.64% 8.43% NA
Indica Intermediate  786 68.10% 0.00% 23.54% 8.40% NA
Temperate Japonica  767 96.50% 1.80% 1.69% 0.00% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 1.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 3.30% 10.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721581927 A -> DEL N N silent_mutation Average:78.011; most accessible tissue: Callus, score: 97.688 N N N N
vg0721581927 A -> T LOC_Os07g36090.1 upstream_gene_variant ; 2595.0bp to feature; MODIFIER silent_mutation Average:78.011; most accessible tissue: Callus, score: 97.688 N N N N
vg0721581927 A -> T LOC_Os07g36100.1 upstream_gene_variant ; 1223.0bp to feature; MODIFIER silent_mutation Average:78.011; most accessible tissue: Callus, score: 97.688 N N N N
vg0721581927 A -> T LOC_Os07g36110.1 upstream_gene_variant ; 930.0bp to feature; MODIFIER silent_mutation Average:78.011; most accessible tissue: Callus, score: 97.688 N N N N
vg0721581927 A -> T LOC_Os07g36090.3 upstream_gene_variant ; 2595.0bp to feature; MODIFIER silent_mutation Average:78.011; most accessible tissue: Callus, score: 97.688 N N N N
vg0721581927 A -> T LOC_Os07g36090.2 upstream_gene_variant ; 2595.0bp to feature; MODIFIER silent_mutation Average:78.011; most accessible tissue: Callus, score: 97.688 N N N N
vg0721581927 A -> T LOC_Os07g36110.2 upstream_gene_variant ; 930.0bp to feature; MODIFIER silent_mutation Average:78.011; most accessible tissue: Callus, score: 97.688 N N N N
vg0721581927 A -> T LOC_Os07g36100-LOC_Os07g36110 intergenic_region ; MODIFIER silent_mutation Average:78.011; most accessible tissue: Callus, score: 97.688 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721581927 A T 0.01 0.01 -0.01 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721581927 5.67E-07 1.05E-06 mr1691 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721581927 1.36E-06 4.16E-06 mr1720 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251