\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721470198:

Variant ID: vg0721470198 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21470198
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTTCTCTCATTTTAGATGGAACTAAAATTGTTTGGCTGAGCTCCAGCTCCACGCTGTGCCAAACAAGCCCTTAGCTTACCATACCTCCGTCACAAAAT[A/G]
TAACAAGTAGCTAAAAATTGTTACATCATGAAATGGAGGTAGTAATAGAGACGTAGAGCCCAGGAGAGTGTTTTTGCTCGGATAAAAGGTGAAGTATTTA

Reverse complement sequence

TAAATACTTCACCTTTTATCCGAGCAAAAACACTCTCCTGGGCTCTACGTCTCTATTACTACCTCCATTTCATGATGTAACAATTTTTAGCTACTTGTTA[T/C]
ATTTTGTGACGGAGGTATGGTAAGCTAAGGGCTTGTTTGGCACAGCGTGGAGCTGGAGCTCAGCCAAACAATTTTAGTTCCATCTAAAATGAGAGAAGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 23.70% 0.06% 0.00% NA
All Indica  2759 93.20% 6.80% 0.04% 0.00% NA
All Japonica  1512 42.70% 57.30% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 86.20% 13.80% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.00% 0.13% 0.00% NA
Temperate Japonica  767 51.60% 48.20% 0.13% 0.00% NA
Tropical Japonica  504 26.60% 73.40% 0.00% 0.00% NA
Japonica Intermediate  241 47.70% 52.30% 0.00% 0.00% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721470198 A -> G LOC_Os07g35870.1 upstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:86.827; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N
vg0721470198 A -> G LOC_Os07g35880.1 upstream_gene_variant ; 857.0bp to feature; MODIFIER silent_mutation Average:86.827; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N
vg0721470198 A -> G LOC_Os07g35870.2 upstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:86.827; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N
vg0721470198 A -> G LOC_Os07g35860.1 downstream_gene_variant ; 3820.0bp to feature; MODIFIER silent_mutation Average:86.827; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N
vg0721470198 A -> G LOC_Os07g35870-LOC_Os07g35880 intergenic_region ; MODIFIER silent_mutation Average:86.827; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721470198 A G 0.0 0.0 0.0 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721470198 NA 2.32E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721470198 NA 1.64E-11 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721470198 NA 9.59E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721470198 NA 9.43E-08 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721470198 NA 3.50E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721470198 NA 1.47E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721470198 NA 2.69E-08 mr1524_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721470198 NA 2.80E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721470198 NA 4.18E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721470198 NA 2.96E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251