\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721456711:

Variant ID: vg0721456711 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21456711
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCAGCTCTCTCGATCGGTCATGATGAGTGGATCGAGCAAGGCACGCCACAGCACCCGTCACGGGGGCTGACATGACATATGCATATATGCTCACCTGTC[T/G]
ATATGATCGACGATCGAGATCAGCACCCGCGAAAACGGTGGTGTTCGCCACAAACCGTGGGCGGTAGCTCGGCGGGCTCGGCCCCAGACTCCCTGGCAGG

Reverse complement sequence

CCTGCCAGGGAGTCTGGGGCCGAGCCCGCCGAGCTACCGCCCACGGTTTGTGGCGAACACCACCGTTTTCGCGGGTGCTGATCTCGATCGTCGATCATAT[A/C]
GACAGGTGAGCATATATGCATATGTCATGTCAGCCCCCGTGACGGGTGCTGTGGCGTGCCTTGCTCGATCCACTCATCATGACCGATCGAGAGAGCTGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 7.20% 0.08% 0.00% NA
All Indica  2759 92.00% 7.90% 0.11% 0.00% NA
All Japonica  1512 94.20% 5.80% 0.07% 0.00% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 84.50% 15.50% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 94.20% 5.60% 0.22% 0.00% NA
Indica Intermediate  786 90.70% 9.20% 0.13% 0.00% NA
Temperate Japonica  767 88.80% 11.10% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721456711 T -> G LOC_Os07g35840.1 upstream_gene_variant ; 592.0bp to feature; MODIFIER silent_mutation Average:98.625; most accessible tissue: Minghui63 root, score: 99.924 N N N N
vg0721456711 T -> G LOC_Os07g35820-LOC_Os07g35840 intergenic_region ; MODIFIER silent_mutation Average:98.625; most accessible tissue: Minghui63 root, score: 99.924 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721456711 T G 0.09 0.19 0.17 0.08 0.15 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721456711 NA 7.46E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721456711 NA 8.88E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721456711 NA 9.57E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721456711 NA 5.01E-06 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721456711 NA 2.12E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721456711 NA 7.53E-06 mr1689_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721456711 NA 2.72E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251