\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721444375:

Variant ID: vg0721444375 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21444375
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCGTACCGCACGGTGGCGTTGAGGAGCTCGGTGACCGCGCGGTCGTAGCCGGCGACGTCGGTGCTGGTGATGTTGGTGCCGCTTATGAGGAGGCTCACC[T/C,G]
CGCCGGAGTTGTTGGTGGCGGCGAGGAAGTCGCCCCTGTCGGAGAACTGGGCGTAGCATTGGTTGTAGACGAGGATGGCGTCCTTGGTGCGGTTGCAGGT

Reverse complement sequence

ACCTGCAACCGCACCAAGGACGCCATCCTCGTCTACAACCAATGCTACGCCCAGTTCTCCGACAGGGGCGACTTCCTCGCCGCCACCAACAACTCCGGCG[A/G,C]
GGTGAGCCTCCTCATAAGCGGCACCAACATCACCAGCACCGACGTCGCCGGCTACGACCGCGCGGTCACCGAGCTCCTCAACGCCACCGTGCGGTACGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.30% 33.00% 5.78% 24.86% G: 0.08%
All Indica  2759 36.00% 18.20% 7.39% 38.31% G: 0.11%
All Japonica  1512 42.10% 50.90% 3.64% 3.31% NA
Aus  269 7.10% 69.50% 3.35% 20.07% NA
Indica I  595 14.60% 17.00% 9.58% 58.82% NA
Indica II  465 64.10% 7.70% 4.30% 23.87% NA
Indica III  913 35.30% 25.10% 6.90% 32.53% G: 0.22%
Indica Intermediate  786 36.30% 17.40% 8.14% 38.04% G: 0.13%
Temperate Japonica  767 22.70% 73.30% 2.22% 1.83% NA
Tropical Japonica  504 65.10% 26.00% 3.77% 5.16% NA
Japonica Intermediate  241 56.00% 32.00% 7.88% 4.15% NA
VI/Aromatic  96 34.40% 63.50% 0.00% 2.08% NA
Intermediate  90 38.90% 41.10% 5.56% 13.33% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721444375 T -> DEL LOC_Os07g35810.1 N frameshift_variant Average:89.65; most accessible tissue: Minghui63 young leaf, score: 96.742 N N N N
vg0721444375 T -> G LOC_Os07g35810.1 missense_variant ; p.Glu139Ala; MODERATE nonsynonymous_codon ; E139A Average:89.65; most accessible tissue: Minghui63 young leaf, score: 96.742 benign -0.131 TOLERATED 0.62
vg0721444375 T -> C LOC_Os07g35810.1 missense_variant ; p.Glu139Gly; MODERATE nonsynonymous_codon ; E139G Average:89.65; most accessible tissue: Minghui63 young leaf, score: 96.742 benign -0.127 TOLERATED 0.36

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721444375 T C 0.02 0.0 0.03 0.03 0.03 0.03
vg0721444375 T G 0.01 -0.01 0.02 0.01 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721444375 NA 1.21E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721444375 NA 4.02E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721444375 NA 2.80E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721444375 3.83E-06 3.83E-06 mr1899 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721444375 1.21E-06 7.33E-09 mr1910 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721444375 NA 2.06E-11 mr1946 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721444375 NA 8.81E-07 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721444375 NA 3.89E-10 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721444375 NA 8.89E-07 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721444375 NA 1.11E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251