\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721439672:

Variant ID: vg0721439672 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21439672
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.14, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCGACACCAATGTTGGTGGTGCCGTTCTCCTTCACATTAGTGACTTAGCTTTCACCCGAGGGTGGAGAGGACGGCGCCAACGTCCTTGGTGCTGTCAT[G/A]
TTGGACCACGGCACCAACTACATTGGCGCCGCGAAAAGCACCATTTCTAAAATAAGTTATTTTAAGGATTTATTTGTAGAATAAGTTTTTTTTCAAAAGA

Reverse complement sequence

TCTTTTGAAAAAAAACTTATTCTACAAATAAATCCTTAAAATAACTTATTTTAGAAATGGTGCTTTTCGCGGCGCCAATGTAGTTGGTGCCGTGGTCCAA[C/T]
ATGACAGCACCAAGGACGTTGGCGCCGTCCTCTCCACCCTCGGGTGAAAGCTAAGTCACTAATGTGAAGGAGAACGGCACCACCAACATTGGTGTCGAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 37.00% 0.02% 0.00% NA
All Indica  2759 78.90% 21.10% 0.04% 0.00% NA
All Japonica  1512 28.20% 71.80% 0.00% 0.00% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 84.00% 16.00% 0.00% 0.00% NA
Indica II  465 87.10% 12.90% 0.00% 0.00% NA
Indica III  913 80.30% 19.60% 0.11% 0.00% NA
Indica Intermediate  786 68.40% 31.60% 0.00% 0.00% NA
Temperate Japonica  767 42.80% 57.20% 0.00% 0.00% NA
Tropical Japonica  504 6.30% 93.70% 0.00% 0.00% NA
Japonica Intermediate  241 27.40% 72.60% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721439672 G -> A LOC_Os07g35790.1 upstream_gene_variant ; 2001.0bp to feature; MODIFIER silent_mutation Average:54.441; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0721439672 G -> A LOC_Os07g35810.1 downstream_gene_variant ; 1365.0bp to feature; MODIFIER silent_mutation Average:54.441; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0721439672 G -> A LOC_Os07g35800.1 intron_variant ; MODIFIER silent_mutation Average:54.441; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721439672 NA 2.94E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672 NA 2.47E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672 NA 2.16E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672 NA 2.98E-07 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672 8.58E-06 NA mr1531_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672 NA 2.10E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672 NA 1.57E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672 NA 7.19E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251