Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721381168:

Variant ID: vg0721381168 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21381168
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAGGTTGATGCGTGGGGATGCCCTACTGCATCACGTCAGTATATTATTATTTATTGAATCCACCATTGTGGCTGTAATTAGAATTAATAAGATGGTATT[T/G]
CTTAGAAATTGAAACTGACCGGAGTGGATAATAAAAGTCAGGAGTGATCACGATGTATGGCATGATGAATTGTCACTGTTGTCAATTATGCTGTTATTAG

Reverse complement sequence

CTAATAACAGCATAATTGACAACAGTGACAATTCATCATGCCATACATCGTGATCACTCCTGACTTTTATTATCCACTCCGGTCAGTTTCAATTTCTAAG[A/C]
AATACCATCTTATTAATTCTAATTACAGCCACAATGGTGGATTCAATAAATAATAATATACTGACGTGATGCAGTAGGGCATCCCCACGCATCAACCTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.90%	45.90%	4.10%	0.02%	NA
All Indica	2759	43.90%	49.60%	6.45%	0.04%	NA
All Japonica	1512	58.30%	40.90%	0.86%	0.00%	NA
Aus	269	72.90%	27.10%	0.00%	0.00%	NA
Indica I	595	19.00%	81.00%	0.00%	0.00%	NA
Indica II	465	61.50%	30.80%	7.74%	0.00%	NA
Indica III	913	48.30%	43.00%	8.54%	0.11%	NA
Indica Intermediate	786	47.30%	44.50%	8.14%	0.00%	NA
Temperate Japonica	767	35.30%	64.30%	0.39%	0.00%	NA
Tropical Japonica	504	86.50%	12.10%	1.39%	0.00%	NA
Japonica Intermediate	241	72.20%	26.60%	1.24%	0.00%	NA
VI/Aromatic	96	37.50%	62.50%	0.00%	0.00%	NA
Intermediate	90	38.90%	57.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721381168	T -> DEL	N	N	silent_mutation	Average:79.894; most accessible tissue: Zhenshan97 root, score: 95.855	N	N	N	N
vg0721381168	T -> G	LOC_Os07g35690.1	3_prime_UTR_variant ; 150.0bp to feature; MODIFIER	silent_mutation	Average:79.894; most accessible tissue: Zhenshan97 root, score: 95.855	N	N	N	N
vg0721381168	T -> G	LOC_Os07g35690.2	3_prime_UTR_variant ; 150.0bp to feature; MODIFIER	silent_mutation	Average:79.894; most accessible tissue: Zhenshan97 root, score: 95.855	N	N	N	N
vg0721381168	T -> G	LOC_Os07g35700.1	downstream_gene_variant ; 3579.0bp to feature; MODIFIER	silent_mutation	Average:79.894; most accessible tissue: Zhenshan97 root, score: 95.855	N	N	N	N
vg0721381168	T -> G	LOC_Os07g35700.2	downstream_gene_variant ; 3579.0bp to feature; MODIFIER	silent_mutation	Average:79.894; most accessible tissue: Zhenshan97 root, score: 95.855	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0721381168	T	G	0.2	-0.02	-0.11	0.0	0.02	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721381168	NA	8.30E-07	mr1186	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721381168	NA	6.30E-07	mr1616	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721381168	4.05E-06	NA	mr1627	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721381168	NA	4.94E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721381168	NA	5.00E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721381168	NA	9.58E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251