Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721364910:

Variant ID: vg0721364910 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21364910
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGTGGTTCAACTTTTTTTTCTCTTTTTCTTTATTTCTTTGCTCTCTAGTGTCTACTATTCCTATCTCTTTGCTACATTGAAGGAGCGTCGGAAAATTC[T/C,A]
AAAATACCCTCTTTCATCTAAGGCTATCATTTATTTTATCTATTTTGTCACTTTGTGAATCTGACGGCTAATATTAATCAGATGAATGTGGCTCATACTA

Reverse complement sequence

TAGTATGAGCCACATTCATCTGATTAATATTAGCCGTCAGATTCACAAAGTGACAAAATAGATAAAATAAATGATAGCCTTAGATGAAAGAGGGTATTTT[A/G,T]
GAATTTTCCGACGCTCCTTCAATGTAGCAAAGAGATAGGAATAGTAGACACTAGAGAGCAAAGAAATAAAGAAAAAGAGAAAAAAAAGTTGAACCACATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.10%	31.80%	0.04%	0.00%	A: 0.02%
All Indica	2759	86.30%	13.60%	0.07%	0.00%	A: 0.04%
All Japonica	1512	46.40%	53.60%	0.00%	0.00%	NA
Aus	269	14.50%	85.50%	0.00%	0.00%	NA
Indica I	595	96.30%	3.40%	0.34%	0.00%	NA
Indica II	465	85.20%	14.80%	0.00%	0.00%	NA
Indica III	913	80.50%	19.40%	0.00%	0.00%	A: 0.11%
Indica Intermediate	786	86.10%	13.90%	0.00%	0.00%	NA
Temperate Japonica	767	17.90%	82.10%	0.00%	0.00%	NA
Tropical Japonica	504	87.50%	12.50%	0.00%	0.00%	NA
Japonica Intermediate	241	51.50%	48.50%	0.00%	0.00%	NA
VI/Aromatic	96	42.70%	57.30%	0.00%	0.00%	NA
Intermediate	90	61.10%	38.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721364910	T -> A	LOC_Os07g35670.1	downstream_gene_variant ; 2602.0bp to feature; MODIFIER	silent_mutation	Average:46.018; most accessible tissue: Minghui63 root, score: 63.193	N	N	N	N
vg0721364910	T -> A	LOC_Os07g35680.1	downstream_gene_variant ; 3059.0bp to feature; MODIFIER	silent_mutation	Average:46.018; most accessible tissue: Minghui63 root, score: 63.193	N	N	N	N
vg0721364910	T -> A	LOC_Os07g35660.1	intron_variant ; MODIFIER	silent_mutation	Average:46.018; most accessible tissue: Minghui63 root, score: 63.193	N	N	N	N
vg0721364910	T -> C	LOC_Os07g35670.1	downstream_gene_variant ; 2602.0bp to feature; MODIFIER	silent_mutation	Average:46.018; most accessible tissue: Minghui63 root, score: 63.193	N	N	N	N
vg0721364910	T -> C	LOC_Os07g35680.1	downstream_gene_variant ; 3059.0bp to feature; MODIFIER	silent_mutation	Average:46.018; most accessible tissue: Minghui63 root, score: 63.193	N	N	N	N
vg0721364910	T -> C	LOC_Os07g35660.1	intron_variant ; MODIFIER	silent_mutation	Average:46.018; most accessible tissue: Minghui63 root, score: 63.193	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721364910	NA	1.73E-08	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	3.81E-07	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	2.28E-09	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	3.07E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	1.37E-11	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	3.06E-06	7.69E-12	mr1510_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	9.19E-08	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	2.05E-20	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	2.46E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	1.28E-15	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	4.67E-06	mr1679_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	3.48E-07	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	2.56E-09	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	1.44E-16	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	5.16E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910	NA	5.26E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251