\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721364910:

Variant ID: vg0721364910 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21364910
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGTGGTTCAACTTTTTTTTCTCTTTTTCTTTATTTCTTTGCTCTCTAGTGTCTACTATTCCTATCTCTTTGCTACATTGAAGGAGCGTCGGAAAATTC[T/C,A]
AAAATACCCTCTTTCATCTAAGGCTATCATTTATTTTATCTATTTTGTCACTTTGTGAATCTGACGGCTAATATTAATCAGATGAATGTGGCTCATACTA

Reverse complement sequence

TAGTATGAGCCACATTCATCTGATTAATATTAGCCGTCAGATTCACAAAGTGACAAAATAGATAAAATAAATGATAGCCTTAGATGAAAGAGGGTATTTT[A/G,T]
GAATTTTCCGACGCTCCTTCAATGTAGCAAAGAGATAGGAATAGTAGACACTAGAGAGCAAAGAAATAAAGAAAAAGAGAAAAAAAAGTTGAACCACATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 31.80% 0.04% 0.00% A: 0.02%
All Indica  2759 86.30% 13.60% 0.07% 0.00% A: 0.04%
All Japonica  1512 46.40% 53.60% 0.00% 0.00% NA
Aus  269 14.50% 85.50% 0.00% 0.00% NA
Indica I  595 96.30% 3.40% 0.34% 0.00% NA
Indica II  465 85.20% 14.80% 0.00% 0.00% NA
Indica III  913 80.50% 19.40% 0.00% 0.00% A: 0.11%
Indica Intermediate  786 86.10% 13.90% 0.00% 0.00% NA
Temperate Japonica  767 17.90% 82.10% 0.00% 0.00% NA
Tropical Japonica  504 87.50% 12.50% 0.00% 0.00% NA
Japonica Intermediate  241 51.50% 48.50% 0.00% 0.00% NA
VI/Aromatic  96 42.70% 57.30% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721364910 T -> A LOC_Os07g35670.1 downstream_gene_variant ; 2602.0bp to feature; MODIFIER silent_mutation Average:46.018; most accessible tissue: Minghui63 root, score: 63.193 N N N N
vg0721364910 T -> A LOC_Os07g35680.1 downstream_gene_variant ; 3059.0bp to feature; MODIFIER silent_mutation Average:46.018; most accessible tissue: Minghui63 root, score: 63.193 N N N N
vg0721364910 T -> A LOC_Os07g35660.1 intron_variant ; MODIFIER silent_mutation Average:46.018; most accessible tissue: Minghui63 root, score: 63.193 N N N N
vg0721364910 T -> C LOC_Os07g35670.1 downstream_gene_variant ; 2602.0bp to feature; MODIFIER silent_mutation Average:46.018; most accessible tissue: Minghui63 root, score: 63.193 N N N N
vg0721364910 T -> C LOC_Os07g35680.1 downstream_gene_variant ; 3059.0bp to feature; MODIFIER silent_mutation Average:46.018; most accessible tissue: Minghui63 root, score: 63.193 N N N N
vg0721364910 T -> C LOC_Os07g35660.1 intron_variant ; MODIFIER silent_mutation Average:46.018; most accessible tissue: Minghui63 root, score: 63.193 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721364910 NA 1.73E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 3.81E-07 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 2.28E-09 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 3.07E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 1.37E-11 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 3.06E-06 7.69E-12 mr1510_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 9.19E-08 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 2.05E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 2.46E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 1.28E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 4.67E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 3.48E-07 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 2.56E-09 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 1.44E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 5.16E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721364910 NA 5.26E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251