\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721363546:

Variant ID: vg0721363546 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21363546
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCTGCCCGCTGCTTCTCCTTTTTATTGTCACTGAGATTTTAAAAATCGAATATGATGATCAATGTGTTTTTTTTTTACTTTATAGAAGTCTCGACAACC[G/A]
CCTTACTCGTTTGATTCACGGCCTACCTGATGTTCCTCCTTTTAATCGTCATTAGGATTCTATTTGGTGTTTTATTAACAATTTTTATATGTCGTATCAA

Reverse complement sequence

TTGATACGACATATAAAAATTGTTAATAAAACACCAAATAGAATCCTAATGACGATTAAAAGGAGGAACATCAGGTAGGCCGTGAATCAAACGAGTAAGG[C/T]
GGTTGTCGAGACTTCTATAAAGTAAAAAAAAAACACATTGATCATCATATTCGATTTTTAAAATCTCAGTGACAATAAAAAGGAGAAGCAGCGGGCAGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.40% 35.70% 2.05% 21.90% NA
All Indica  2759 24.10% 59.30% 3.12% 13.56% NA
All Japonica  1512 58.10% 0.90% 0.53% 40.48% NA
Aus  269 95.50% 3.70% 0.00% 0.74% NA
Indica I  595 9.40% 78.00% 1.18% 11.43% NA
Indica II  465 16.80% 77.20% 1.94% 4.09% NA
Indica III  913 37.90% 40.70% 4.93% 16.43% NA
Indica Intermediate  786 23.40% 56.00% 3.18% 17.43% NA
Temperate Japonica  767 83.10% 0.70% 0.39% 15.91% NA
Tropical Japonica  504 23.20% 0.60% 0.99% 75.20% NA
Japonica Intermediate  241 51.90% 2.10% 0.00% 46.06% NA
VI/Aromatic  96 66.70% 1.00% 0.00% 32.29% NA
Intermediate  90 48.90% 30.00% 3.33% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721363546 G -> DEL N N silent_mutation Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0721363546 G -> A LOC_Os07g35670.1 downstream_gene_variant ; 3966.0bp to feature; MODIFIER silent_mutation Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0721363546 G -> A LOC_Os07g35680.1 downstream_gene_variant ; 4423.0bp to feature; MODIFIER silent_mutation Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0721363546 G -> A LOC_Os07g35660.1 intron_variant ; MODIFIER silent_mutation Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721363546 NA 3.61E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 9.41E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 4.00E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 5.49E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 4.07E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 1.60E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 3.24E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 1.87E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 8.18E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 1.62E-08 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 2.84E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 3.69E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 1.95E-06 7.52E-08 mr1521_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 3.29E-16 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 6.12E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 9.39E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 3.90E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 2.88E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546 NA 1.90E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251