Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721363546:

Variant ID: vg0721363546 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21363546
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCTGCCCGCTGCTTCTCCTTTTTATTGTCACTGAGATTTTAAAAATCGAATATGATGATCAATGTGTTTTTTTTTTACTTTATAGAAGTCTCGACAACC[G/A]
CCTTACTCGTTTGATTCACGGCCTACCTGATGTTCCTCCTTTTAATCGTCATTAGGATTCTATTTGGTGTTTTATTAACAATTTTTATATGTCGTATCAA

Reverse complement sequence

TTGATACGACATATAAAAATTGTTAATAAAACACCAAATAGAATCCTAATGACGATTAAAAGGAGGAACATCAGGTAGGCCGTGAATCAAACGAGTAAGG[C/T]
GGTTGTCGAGACTTCTATAAAGTAAAAAAAAAACACATTGATCATCATATTCGATTTTTAAAATCTCAGTGACAATAAAAAGGAGAAGCAGCGGGCAGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.40%	35.70%	2.05%	21.90%	NA
All Indica	2759	24.10%	59.30%	3.12%	13.56%	NA
All Japonica	1512	58.10%	0.90%	0.53%	40.48%	NA
Aus	269	95.50%	3.70%	0.00%	0.74%	NA
Indica I	595	9.40%	78.00%	1.18%	11.43%	NA
Indica II	465	16.80%	77.20%	1.94%	4.09%	NA
Indica III	913	37.90%	40.70%	4.93%	16.43%	NA
Indica Intermediate	786	23.40%	56.00%	3.18%	17.43%	NA
Temperate Japonica	767	83.10%	0.70%	0.39%	15.91%	NA
Tropical Japonica	504	23.20%	0.60%	0.99%	75.20%	NA
Japonica Intermediate	241	51.90%	2.10%	0.00%	46.06%	NA
VI/Aromatic	96	66.70%	1.00%	0.00%	32.29%	NA
Intermediate	90	48.90%	30.00%	3.33%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721363546	G -> DEL	N	N	silent_mutation	Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0721363546	G -> A	LOC_Os07g35670.1	downstream_gene_variant ; 3966.0bp to feature; MODIFIER	silent_mutation	Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0721363546	G -> A	LOC_Os07g35680.1	downstream_gene_variant ; 4423.0bp to feature; MODIFIER	silent_mutation	Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0721363546	G -> A	LOC_Os07g35660.1	intron_variant ; MODIFIER	silent_mutation	Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721363546	NA	3.61E-08	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	9.41E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	4.00E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	5.49E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	4.07E-16	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	1.60E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	3.24E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	1.87E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	8.18E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	1.62E-08	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	2.84E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	3.69E-24	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	1.95E-06	7.52E-08	mr1521_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	3.29E-16	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	6.12E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	9.39E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	3.90E-06	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	2.88E-16	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721363546	NA	1.90E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251