\
| Variant ID: vg0721363546 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21363546 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCCTGCCCGCTGCTTCTCCTTTTTATTGTCACTGAGATTTTAAAAATCGAATATGATGATCAATGTGTTTTTTTTTTACTTTATAGAAGTCTCGACAACC[G/A]
CCTTACTCGTTTGATTCACGGCCTACCTGATGTTCCTCCTTTTAATCGTCATTAGGATTCTATTTGGTGTTTTATTAACAATTTTTATATGTCGTATCAA
TTGATACGACATATAAAAATTGTTAATAAAACACCAAATAGAATCCTAATGACGATTAAAAGGAGGAACATCAGGTAGGCCGTGAATCAAACGAGTAAGG[C/T]
GGTTGTCGAGACTTCTATAAAGTAAAAAAAAAACACATTGATCATCATATTCGATTTTTAAAATCTCAGTGACAATAAAAAGGAGAAGCAGCGGGCAGGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.40% | 35.70% | 2.05% | 21.90% | NA |
| All Indica | 2759 | 24.10% | 59.30% | 3.12% | 13.56% | NA |
| All Japonica | 1512 | 58.10% | 0.90% | 0.53% | 40.48% | NA |
| Aus | 269 | 95.50% | 3.70% | 0.00% | 0.74% | NA |
| Indica I | 595 | 9.40% | 78.00% | 1.18% | 11.43% | NA |
| Indica II | 465 | 16.80% | 77.20% | 1.94% | 4.09% | NA |
| Indica III | 913 | 37.90% | 40.70% | 4.93% | 16.43% | NA |
| Indica Intermediate | 786 | 23.40% | 56.00% | 3.18% | 17.43% | NA |
| Temperate Japonica | 767 | 83.10% | 0.70% | 0.39% | 15.91% | NA |
| Tropical Japonica | 504 | 23.20% | 0.60% | 0.99% | 75.20% | NA |
| Japonica Intermediate | 241 | 51.90% | 2.10% | 0.00% | 46.06% | NA |
| VI/Aromatic | 96 | 66.70% | 1.00% | 0.00% | 32.29% | NA |
| Intermediate | 90 | 48.90% | 30.00% | 3.33% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721363546 | G -> DEL | N | N | silent_mutation | Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0721363546 | G -> A | LOC_Os07g35670.1 | downstream_gene_variant ; 3966.0bp to feature; MODIFIER | silent_mutation | Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0721363546 | G -> A | LOC_Os07g35680.1 | downstream_gene_variant ; 4423.0bp to feature; MODIFIER | silent_mutation | Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0721363546 | G -> A | LOC_Os07g35660.1 | intron_variant ; MODIFIER | silent_mutation | Average:22.521; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721363546 | NA | 3.61E-08 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 9.41E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 4.00E-07 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 5.49E-09 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 4.07E-16 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 1.60E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 3.24E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 1.87E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 8.18E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 1.62E-08 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 2.84E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 3.69E-24 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | 1.95E-06 | 7.52E-08 | mr1521_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 3.29E-16 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 6.12E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 9.39E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 3.90E-06 | mr1739_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 2.88E-16 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721363546 | NA | 1.90E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |