Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721357298:

Variant ID: vg0721357298 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21357298
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.27, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

TGAATAGAATGAATGGTTAAAGATATATTAAAAGTTAACGTCGTCAAAACAACCAGCGCATGTGGTCTGTGAATCATACTAATTAATCTCTAACGGAAAC[A/G]
ATCCTTGAAAAAGAAAAAAAAAGGACAGAAAAAACATTTAAATTGCCTTGGAAAAACTCATCTCCGAATCGAATGATTGCCAAAATAGCTCTCAACTAAA

Reverse complement sequence

TTTAGTTGAGAGCTATTTTGGCAATCATTCGATTCGGAGATGAGTTTTTCCAAGGCAATTTAAATGTTTTTTCTGTCCTTTTTTTTTCTTTTTCAAGGAT[T/C]
GTTTCCGTTAGAGATTAATTAGTATGATTCACAGACCACATGCGCTGGTTGTTTTGACGACGTTAACTTTTAATATATCTTTAACCATTCATTCTATTCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	33.50%	0.66%	0.23%	NA
All Indica	2759	78.30%	21.40%	0.29%	0.00%	NA
All Japonica	1512	53.60%	44.20%	1.46%	0.73%	NA
Aus	269	4.50%	95.50%	0.00%	0.00%	NA
Indica I	595	82.90%	17.00%	0.17%	0.00%	NA
Indica II	465	92.50%	7.30%	0.22%	0.00%	NA
Indica III	913	73.90%	26.10%	0.00%	0.00%	NA
Indica Intermediate	786	71.60%	27.60%	0.76%	0.00%	NA
Temperate Japonica	767	81.40%	16.00%	2.61%	0.00%	NA
Tropical Japonica	504	13.70%	84.10%	0.00%	2.18%	NA
Japonica Intermediate	241	48.50%	50.60%	0.83%	0.00%	NA
VI/Aromatic	96	64.60%	35.40%	0.00%	0.00%	NA
Intermediate	90	63.30%	35.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721357298	A -> DEL	N	N	silent_mutation	Average:41.348; most accessible tissue: Callus, score: 80.488	N	N	N	N
vg0721357298	A -> G	LOC_Os07g35650.1	upstream_gene_variant ; 646.0bp to feature; MODIFIER	silent_mutation	Average:41.348; most accessible tissue: Callus, score: 80.488	N	N	N	N
vg0721357298	A -> G	LOC_Os07g35660.1	upstream_gene_variant ; 2355.0bp to feature; MODIFIER	silent_mutation	Average:41.348; most accessible tissue: Callus, score: 80.488	N	N	N	N
vg0721357298	A -> G	LOC_Os07g35650-LOC_Os07g35660	intergenic_region ; MODIFIER	silent_mutation	Average:41.348; most accessible tissue: Callus, score: 80.488	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721357298	NA	5.33E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	8.07E-07	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	1.67E-13	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	2.60E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	1.32E-15	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	4.89E-12	mr1260	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	3.18E-15	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	3.81E-07	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	1.85E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	1.87E-18	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	4.46E-09	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	3.60E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	2.58E-07	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	2.36E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	2.74E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	1.20E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	1.55E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	8.79E-08	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	1.78E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	1.63E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	8.57E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	5.48E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	1.91E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	8.73E-06	mr1492_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	9.19E-08	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	3.10E-06	mr1944_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	5.16E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298	NA	5.26E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251