\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721357298:

Variant ID: vg0721357298 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21357298
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.27, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TGAATAGAATGAATGGTTAAAGATATATTAAAAGTTAACGTCGTCAAAACAACCAGCGCATGTGGTCTGTGAATCATACTAATTAATCTCTAACGGAAAC[A/G]
ATCCTTGAAAAAGAAAAAAAAAGGACAGAAAAAACATTTAAATTGCCTTGGAAAAACTCATCTCCGAATCGAATGATTGCCAAAATAGCTCTCAACTAAA

Reverse complement sequence

TTTAGTTGAGAGCTATTTTGGCAATCATTCGATTCGGAGATGAGTTTTTCCAAGGCAATTTAAATGTTTTTTCTGTCCTTTTTTTTTCTTTTTCAAGGAT[T/C]
GTTTCCGTTAGAGATTAATTAGTATGATTCACAGACCACATGCGCTGGTTGTTTTGACGACGTTAACTTTTAATATATCTTTAACCATTCATTCTATTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 33.50% 0.66% 0.23% NA
All Indica  2759 78.30% 21.40% 0.29% 0.00% NA
All Japonica  1512 53.60% 44.20% 1.46% 0.73% NA
Aus  269 4.50% 95.50% 0.00% 0.00% NA
Indica I  595 82.90% 17.00% 0.17% 0.00% NA
Indica II  465 92.50% 7.30% 0.22% 0.00% NA
Indica III  913 73.90% 26.10% 0.00% 0.00% NA
Indica Intermediate  786 71.60% 27.60% 0.76% 0.00% NA
Temperate Japonica  767 81.40% 16.00% 2.61% 0.00% NA
Tropical Japonica  504 13.70% 84.10% 0.00% 2.18% NA
Japonica Intermediate  241 48.50% 50.60% 0.83% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721357298 A -> DEL N N silent_mutation Average:41.348; most accessible tissue: Callus, score: 80.488 N N N N
vg0721357298 A -> G LOC_Os07g35650.1 upstream_gene_variant ; 646.0bp to feature; MODIFIER silent_mutation Average:41.348; most accessible tissue: Callus, score: 80.488 N N N N
vg0721357298 A -> G LOC_Os07g35660.1 upstream_gene_variant ; 2355.0bp to feature; MODIFIER silent_mutation Average:41.348; most accessible tissue: Callus, score: 80.488 N N N N
vg0721357298 A -> G LOC_Os07g35650-LOC_Os07g35660 intergenic_region ; MODIFIER silent_mutation Average:41.348; most accessible tissue: Callus, score: 80.488 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721357298 NA 5.33E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 8.07E-07 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 1.67E-13 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 2.60E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 1.32E-15 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 4.89E-12 mr1260 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 3.18E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 3.81E-07 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 1.85E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 1.87E-18 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 4.46E-09 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 3.60E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 2.58E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 2.36E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 2.74E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 1.20E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 1.55E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 8.79E-08 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 1.78E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 1.63E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 8.57E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 5.48E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 1.91E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 8.73E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 9.19E-08 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 3.10E-06 mr1944_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 5.16E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721357298 NA 5.26E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251