\
| Variant ID: vg0721331234 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21331234 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 94. )
TATAAGTCAAAAGTTTACATATCCGTTTCAAATTTGAATTTGAATTCAAATATTTTTTATATATAGTATTTCTATACATAAATTTTCCAACTTTGTTTTT[T/A]
TTATTTTTTTTAAATTTATGGTGTAGTAGGAAGAGAAGAAGAGGAGGAAAGGGGAGAGAAGCGTATTGGGGATGGGGTGTGATCGCTGTGGACGACCACC
GGTGGTCGTCCACAGCGATCACACCCCATCCCCAATACGCTTCTCTCCCCTTTCCTCCTCTTCTTCTCTTCCTACTACACCATAAATTTAAAAAAAATAA[A/T]
AAAAACAAAGTTGGAAAATTTATGTATAGAAATACTATATATAAAAAATATTTGAATTCAAATTCAAATTTGAAACGGATATGTAAACTTTTGACTTATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.80% | 35.30% | 0.99% | 7.87% | NA |
| All Indica | 2759 | 28.70% | 59.20% | 1.56% | 10.47% | NA |
| All Japonica | 1512 | 95.00% | 0.20% | 0.26% | 4.50% | NA |
| Aus | 269 | 92.20% | 4.10% | 0.00% | 3.72% | NA |
| Indica I | 595 | 20.70% | 77.80% | 0.17% | 1.34% | NA |
| Indica II | 465 | 20.60% | 78.10% | 0.43% | 0.86% | NA |
| Indica III | 913 | 36.90% | 40.30% | 2.52% | 20.26% | NA |
| Indica Intermediate | 786 | 30.20% | 56.00% | 2.16% | 11.70% | NA |
| Temperate Japonica | 767 | 95.80% | 0.30% | 0.13% | 3.78% | NA |
| Tropical Japonica | 504 | 97.00% | 0.00% | 0.60% | 2.38% | NA |
| Japonica Intermediate | 241 | 88.40% | 0.40% | 0.00% | 11.20% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 24.40% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721331234 | T -> DEL | N | N | silent_mutation | Average:34.168; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0721331234 | T -> A | LOC_Os07g35620.1 | upstream_gene_variant ; 4871.0bp to feature; MODIFIER | silent_mutation | Average:34.168; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0721331234 | T -> A | LOC_Os07g35630.1 | downstream_gene_variant ; 2346.0bp to feature; MODIFIER | silent_mutation | Average:34.168; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0721331234 | T -> A | LOC_Os07g35620-LOC_Os07g35630 | intergenic_region ; MODIFIER | silent_mutation | Average:34.168; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721331234 | NA | 5.71E-06 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 4.46E-09 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 1.79E-11 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 2.52E-08 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 6.64E-17 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 3.47E-06 | mr1045_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 2.72E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 2.38E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 1.26E-16 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 2.98E-07 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 6.35E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 3.78E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 7.18E-11 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 2.76E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 1.01E-18 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 8.61E-14 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 1.82E-07 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 6.55E-36 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 9.64E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 1.23E-06 | mr1266_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 4.87E-06 | mr1266_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 1.60E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 5.02E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 5.51E-06 | mr1320_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 7.13E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 5.87E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 3.78E-08 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 8.76E-06 | mr1407_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 1.34E-24 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 4.28E-07 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 3.39E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 1.10E-12 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 4.90E-06 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 8.41E-06 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 3.42E-10 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 7.26E-06 | mr1788_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 3.33E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 5.92E-14 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 1.79E-07 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 1.99E-20 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 7.80E-07 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721331234 | NA | 3.69E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |