\
| Variant ID: vg0721330014 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21330014 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTATTATGTTTATTCCGAATTTTAGTTAGTTTTAAATTCCTATACGGACTCTATACTCTACTTCTAATATTTCTTATTTTTTAATTCCGTATTTCTATT[A/T]
TTTCTTAATTGTATTTTTATATGGACTCTATACTCTACTTCTAATATACCTTATTTTTAATTCCGAATTTTTATTATTTCTTAATTGTATTTCTATATGG
CCATATAGAAATACAATTAAGAAATAATAAAAATTCGGAATTAAAAATAAGGTATATTAGAAGTAGAGTATAGAGTCCATATAAAAATACAATTAAGAAA[T/A]
AATAGAAATACGGAATTAAAAAATAAGAAATATTAGAAGTAGAGTATAGAGTCCGTATAGGAATTTAAAACTAACTAAAATTCGGAATAAACATAATAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 5.40% | 0.11% | 8.68% | NA |
| All Indica | 2759 | 88.00% | 0.10% | 0.14% | 11.82% | NA |
| All Japonica | 1512 | 79.00% | 16.40% | 0.07% | 4.56% | NA |
| Aus | 269 | 96.30% | 0.00% | 0.00% | 3.72% | NA |
| Indica I | 595 | 98.70% | 0.00% | 0.00% | 1.34% | NA |
| Indica II | 465 | 98.50% | 0.00% | 0.00% | 1.51% | NA |
| Indica III | 913 | 76.80% | 0.00% | 0.11% | 23.11% | NA |
| Indica Intermediate | 786 | 86.60% | 0.30% | 0.38% | 12.72% | NA |
| Temperate Japonica | 767 | 65.20% | 30.90% | 0.00% | 3.91% | NA |
| Tropical Japonica | 504 | 96.60% | 0.80% | 0.20% | 2.38% | NA |
| Japonica Intermediate | 241 | 85.90% | 2.90% | 0.00% | 11.20% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 2.20% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721330014 | A -> DEL | N | N | silent_mutation | Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0721330014 | A -> T | LOC_Os07g35620.1 | upstream_gene_variant ; 3651.0bp to feature; MODIFIER | silent_mutation | Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0721330014 | A -> T | LOC_Os07g35630.1 | downstream_gene_variant ; 3566.0bp to feature; MODIFIER | silent_mutation | Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0721330014 | A -> T | LOC_Os07g35620-LOC_Os07g35630 | intergenic_region ; MODIFIER | silent_mutation | Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721330014 | 6.73E-07 | 1.24E-10 | mr1693_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721330014 | NA | 5.16E-06 | mr1693_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |