\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721330014:

Variant ID: vg0721330014 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21330014
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATTATGTTTATTCCGAATTTTAGTTAGTTTTAAATTCCTATACGGACTCTATACTCTACTTCTAATATTTCTTATTTTTTAATTCCGTATTTCTATT[A/T]
TTTCTTAATTGTATTTTTATATGGACTCTATACTCTACTTCTAATATACCTTATTTTTAATTCCGAATTTTTATTATTTCTTAATTGTATTTCTATATGG

Reverse complement sequence

CCATATAGAAATACAATTAAGAAATAATAAAAATTCGGAATTAAAAATAAGGTATATTAGAAGTAGAGTATAGAGTCCATATAAAAATACAATTAAGAAA[T/A]
AATAGAAATACGGAATTAAAAAATAAGAAATATTAGAAGTAGAGTATAGAGTCCGTATAGGAATTTAAAACTAACTAAAATTCGGAATAAACATAATAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 5.40% 0.11% 8.68% NA
All Indica  2759 88.00% 0.10% 0.14% 11.82% NA
All Japonica  1512 79.00% 16.40% 0.07% 4.56% NA
Aus  269 96.30% 0.00% 0.00% 3.72% NA
Indica I  595 98.70% 0.00% 0.00% 1.34% NA
Indica II  465 98.50% 0.00% 0.00% 1.51% NA
Indica III  913 76.80% 0.00% 0.11% 23.11% NA
Indica Intermediate  786 86.60% 0.30% 0.38% 12.72% NA
Temperate Japonica  767 65.20% 30.90% 0.00% 3.91% NA
Tropical Japonica  504 96.60% 0.80% 0.20% 2.38% NA
Japonica Intermediate  241 85.90% 2.90% 0.00% 11.20% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 2.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721330014 A -> DEL N N silent_mutation Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0721330014 A -> T LOC_Os07g35620.1 upstream_gene_variant ; 3651.0bp to feature; MODIFIER silent_mutation Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0721330014 A -> T LOC_Os07g35630.1 downstream_gene_variant ; 3566.0bp to feature; MODIFIER silent_mutation Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0721330014 A -> T LOC_Os07g35620-LOC_Os07g35630 intergenic_region ; MODIFIER silent_mutation Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721330014 6.73E-07 1.24E-10 mr1693_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721330014 NA 5.16E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251