Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721330014:

Variant ID: vg0721330014 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21330014
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTATTATGTTTATTCCGAATTTTAGTTAGTTTTAAATTCCTATACGGACTCTATACTCTACTTCTAATATTTCTTATTTTTTAATTCCGTATTTCTATT[A/T]
TTTCTTAATTGTATTTTTATATGGACTCTATACTCTACTTCTAATATACCTTATTTTTAATTCCGAATTTTTATTATTTCTTAATTGTATTTCTATATGG

Reverse complement sequence

CCATATAGAAATACAATTAAGAAATAATAAAAATTCGGAATTAAAAATAAGGTATATTAGAAGTAGAGTATAGAGTCCATATAAAAATACAATTAAGAAA[T/A]
AATAGAAATACGGAATTAAAAAATAAGAAATATTAGAAGTAGAGTATAGAGTCCGTATAGGAATTTAAAACTAACTAAAATTCGGAATAAACATAATAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.90%	5.40%	0.11%	8.68%	NA
All Indica	2759	88.00%	0.10%	0.14%	11.82%	NA
All Japonica	1512	79.00%	16.40%	0.07%	4.56%	NA
Aus	269	96.30%	0.00%	0.00%	3.72%	NA
Indica I	595	98.70%	0.00%	0.00%	1.34%	NA
Indica II	465	98.50%	0.00%	0.00%	1.51%	NA
Indica III	913	76.80%	0.00%	0.11%	23.11%	NA
Indica Intermediate	786	86.60%	0.30%	0.38%	12.72%	NA
Temperate Japonica	767	65.20%	30.90%	0.00%	3.91%	NA
Tropical Japonica	504	96.60%	0.80%	0.20%	2.38%	NA
Japonica Intermediate	241	85.90%	2.90%	0.00%	11.20%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	2.20%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721330014	A -> DEL	N	N	silent_mutation	Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0721330014	A -> T	LOC_Os07g35620.1	upstream_gene_variant ; 3651.0bp to feature; MODIFIER	silent_mutation	Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0721330014	A -> T	LOC_Os07g35630.1	downstream_gene_variant ; 3566.0bp to feature; MODIFIER	silent_mutation	Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0721330014	A -> T	LOC_Os07g35620-LOC_Os07g35630	intergenic_region ; MODIFIER	silent_mutation	Average:19.772; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721330014	6.73E-07	1.24E-10	mr1693_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721330014	NA	5.16E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251