Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721323336:

Variant ID: vg0721323336 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21323336
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCTGCATGTACGTACGTACCACTTTTCTACCGAGACGGCAACCAATGCTTCCTTTAATACTGCAAACCACCGTGGCAAAGATCTCAAAGTATGTCTTAG[A/C]
GTTTTTTTTTTAATGCGTGCAGCCATATTAACAAGATAGTACTTCCTCTAAAAAAAACTAGATATAGTATTGGTCATGAATTTGATTAAAAAATGATTTT

Reverse complement sequence

AAAATCATTTTTTAATCAAATTCATGACCAATACTATATCTAGTTTTTTTTAGAGGAAGTACTATCTTGTTAATATGGCTGCACGCATTAAAAAAAAAAC[T/G]
CTAAGACATACTTTGAGATCTTTGCCACGGTGGTTTGCAGTATTAAAGGAAGCATTGGTTGCCGTCTCGGTAGAAAAGTGGTACGTACGTACATGCAGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.30%	41.10%	1.25%	6.37%	NA
All Indica	2759	69.80%	17.80%	1.67%	10.73%	NA
All Japonica	1512	15.30%	84.40%	0.07%	0.20%	NA
Aus	269	86.20%	9.70%	3.72%	0.37%	NA
Indica I	595	81.30%	17.10%	0.17%	1.34%	NA
Indica II	465	80.00%	18.50%	0.00%	1.51%	NA
Indica III	913	59.80%	16.40%	4.16%	19.61%	NA
Indica Intermediate	786	66.70%	19.50%	0.89%	12.98%	NA
Temperate Japonica	767	5.20%	94.50%	0.00%	0.26%	NA
Tropical Japonica	504	29.20%	70.40%	0.20%	0.20%	NA
Japonica Intermediate	241	18.70%	81.30%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	95.80%	1.04%	0.00%	NA
Intermediate	90	34.40%	63.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721323336	A -> DEL	N	N	silent_mutation	Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675	N	N	N	N
vg0721323336	A -> C	LOC_Os07g35610.1	upstream_gene_variant ; 2944.0bp to feature; MODIFIER	silent_mutation	Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675	N	N	N	N
vg0721323336	A -> C	LOC_Os07g35620.1	downstream_gene_variant ; 2365.0bp to feature; MODIFIER	silent_mutation	Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675	N	N	N	N
vg0721323336	A -> C	LOC_Os07g35610-LOC_Os07g35620	intergenic_region ; MODIFIER	silent_mutation	Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721323336	NA	2.55E-08	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336	NA	1.23E-08	mr1161_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336	NA	2.90E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336	NA	8.23E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336	NA	3.03E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336	NA	9.81E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336	NA	4.58E-06	mr1788_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251