\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721323336:

Variant ID: vg0721323336 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21323336
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTGCATGTACGTACGTACCACTTTTCTACCGAGACGGCAACCAATGCTTCCTTTAATACTGCAAACCACCGTGGCAAAGATCTCAAAGTATGTCTTAG[A/C]
GTTTTTTTTTTAATGCGTGCAGCCATATTAACAAGATAGTACTTCCTCTAAAAAAAACTAGATATAGTATTGGTCATGAATTTGATTAAAAAATGATTTT

Reverse complement sequence

AAAATCATTTTTTAATCAAATTCATGACCAATACTATATCTAGTTTTTTTTAGAGGAAGTACTATCTTGTTAATATGGCTGCACGCATTAAAAAAAAAAC[T/G]
CTAAGACATACTTTGAGATCTTTGCCACGGTGGTTTGCAGTATTAAAGGAAGCATTGGTTGCCGTCTCGGTAGAAAAGTGGTACGTACGTACATGCAGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 41.10% 1.25% 6.37% NA
All Indica  2759 69.80% 17.80% 1.67% 10.73% NA
All Japonica  1512 15.30% 84.40% 0.07% 0.20% NA
Aus  269 86.20% 9.70% 3.72% 0.37% NA
Indica I  595 81.30% 17.10% 0.17% 1.34% NA
Indica II  465 80.00% 18.50% 0.00% 1.51% NA
Indica III  913 59.80% 16.40% 4.16% 19.61% NA
Indica Intermediate  786 66.70% 19.50% 0.89% 12.98% NA
Temperate Japonica  767 5.20% 94.50% 0.00% 0.26% NA
Tropical Japonica  504 29.20% 70.40% 0.20% 0.20% NA
Japonica Intermediate  241 18.70% 81.30% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 95.80% 1.04% 0.00% NA
Intermediate  90 34.40% 63.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721323336 A -> DEL N N silent_mutation Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675 N N N N
vg0721323336 A -> C LOC_Os07g35610.1 upstream_gene_variant ; 2944.0bp to feature; MODIFIER silent_mutation Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675 N N N N
vg0721323336 A -> C LOC_Os07g35620.1 downstream_gene_variant ; 2365.0bp to feature; MODIFIER silent_mutation Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675 N N N N
vg0721323336 A -> C LOC_Os07g35610-LOC_Os07g35620 intergenic_region ; MODIFIER silent_mutation Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721323336 NA 2.55E-08 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336 NA 1.23E-08 mr1161_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336 NA 2.90E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336 NA 8.23E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336 NA 3.03E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336 NA 9.81E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721323336 NA 4.58E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251