\
| Variant ID: vg0721323336 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21323336 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCTGCATGTACGTACGTACCACTTTTCTACCGAGACGGCAACCAATGCTTCCTTTAATACTGCAAACCACCGTGGCAAAGATCTCAAAGTATGTCTTAG[A/C]
GTTTTTTTTTTAATGCGTGCAGCCATATTAACAAGATAGTACTTCCTCTAAAAAAAACTAGATATAGTATTGGTCATGAATTTGATTAAAAAATGATTTT
AAAATCATTTTTTAATCAAATTCATGACCAATACTATATCTAGTTTTTTTTAGAGGAAGTACTATCTTGTTAATATGGCTGCACGCATTAAAAAAAAAAC[T/G]
CTAAGACATACTTTGAGATCTTTGCCACGGTGGTTTGCAGTATTAAAGGAAGCATTGGTTGCCGTCTCGGTAGAAAAGTGGTACGTACGTACATGCAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 41.10% | 1.25% | 6.37% | NA |
| All Indica | 2759 | 69.80% | 17.80% | 1.67% | 10.73% | NA |
| All Japonica | 1512 | 15.30% | 84.40% | 0.07% | 0.20% | NA |
| Aus | 269 | 86.20% | 9.70% | 3.72% | 0.37% | NA |
| Indica I | 595 | 81.30% | 17.10% | 0.17% | 1.34% | NA |
| Indica II | 465 | 80.00% | 18.50% | 0.00% | 1.51% | NA |
| Indica III | 913 | 59.80% | 16.40% | 4.16% | 19.61% | NA |
| Indica Intermediate | 786 | 66.70% | 19.50% | 0.89% | 12.98% | NA |
| Temperate Japonica | 767 | 5.20% | 94.50% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 29.20% | 70.40% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 18.70% | 81.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 95.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 63.30% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721323336 | A -> DEL | N | N | silent_mutation | Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675 | N | N | N | N |
| vg0721323336 | A -> C | LOC_Os07g35610.1 | upstream_gene_variant ; 2944.0bp to feature; MODIFIER | silent_mutation | Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675 | N | N | N | N |
| vg0721323336 | A -> C | LOC_Os07g35620.1 | downstream_gene_variant ; 2365.0bp to feature; MODIFIER | silent_mutation | Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675 | N | N | N | N |
| vg0721323336 | A -> C | LOC_Os07g35610-LOC_Os07g35620 | intergenic_region ; MODIFIER | silent_mutation | Average:50.819; most accessible tissue: Zhenshan97 flower, score: 88.675 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721323336 | NA | 2.55E-08 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721323336 | NA | 1.23E-08 | mr1161_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721323336 | NA | 2.90E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721323336 | NA | 8.23E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721323336 | NA | 3.03E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721323336 | NA | 9.81E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721323336 | NA | 4.58E-06 | mr1788_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |