Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721303275:

Variant ID: vg0721303275 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21303275
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

GACCAAACATTGTCCATTCGGTCTCTAATTTAATTGTTAGTGTCGTAGAATGATAGGTCCGCTGGACTTTGAAAGGGATCATCATCGTCCTTCCTAACTT[G/A]
GCATTTGTTTGTTGATTTCGACTGCGAAGGTTATATTTGACATAGACAAGCTTGTTGAGCTTGCTGTGTGTAACTTTGTAACGAATCTTTGTCTGTACGA

Reverse complement sequence

TCGTACAGACAAAGATTCGTTACAAAGTTACACACAGCAAGCTCAACAAGCTTGTCTATGTCAAATATAACCTTCGCAGTCGAAATCAACAAACAAATGC[C/T]
AAGTTAGGAAGGACGATGATGATCCCTTTCAAAGTCCAGCGGACCTATCATTCTACGACACTAACAATTAAATTAGAGACCGAATGGACAATGTTTGGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	36.20%	0.25%	2.73%	NA
All Indica	2759	36.30%	59.00%	0.40%	4.28%	NA
All Japonica	1512	99.50%	0.40%	0.00%	0.07%	NA
Aus	269	90.30%	6.30%	0.00%	3.35%	NA
Indica I	595	22.20%	77.50%	0.17%	0.17%	NA
Indica II	465	21.10%	77.60%	0.22%	1.08%	NA
Indica III	913	49.80%	39.90%	0.55%	9.75%	NA
Indica Intermediate	786	40.20%	56.40%	0.51%	2.93%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	68.80%	31.20%	0.00%	0.00%	NA
Intermediate	90	64.40%	33.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721303275	G -> DEL	N	N	silent_mutation	Average:47.614; most accessible tissue: Callus, score: 78.194	N	N	N	N
vg0721303275	G -> A	LOC_Os07g35580.1	upstream_gene_variant ; 3699.0bp to feature; MODIFIER	silent_mutation	Average:47.614; most accessible tissue: Callus, score: 78.194	N	N	N	N
vg0721303275	G -> A	LOC_Os07g35600.1	intron_variant ; MODIFIER	silent_mutation	Average:47.614; most accessible tissue: Callus, score: 78.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721303275	NA	5.35E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	6.44E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	7.30E-10	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	5.02E-10	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	6.30E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	2.18E-21	mr1870	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	4.27E-07	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	1.33E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	3.84E-10	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	4.17E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	9.69E-21	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	1.89E-13	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	4.74E-08	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	2.33E-09	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	3.20E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	3.29E-07	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	6.00E-24	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	1.40E-07	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	3.34E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	1.24E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	8.51E-06	mr1771_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	8.00E-06	mr1806_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	8.34E-07	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	2.39E-23	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	1.04E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303275	NA	3.60E-11	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251