\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721299763:

Variant ID: vg0721299763 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 21299763
Reference Allele: AAlternative Allele: G,AAGAAAT
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CACCTGAGCCTCCTGCCAAACATCGTCATTAAGAGCCTTTGTCCAATATAGCAAGAACTGAACAAATAACATCGTGGGAATAACAAATAAGGACGAGTCC[A/G,AAGAAAT]
GCAAGGATGATGACAACAAAGAAAACAAATGCAGGTCTTGATGCCTTGATGGTGATGCAGCTCAGCCTTGTCCATCGCATACCAAACAACACAAACGCGC

Reverse complement sequence

GCGCGTTTGTGTTGTTTGGTATGCGATGGACAAGGCTGAGCTGCATCACCATCAAGGCATCAAGACCTGCATTTGTTTTCTTTGTTGTCATCATCCTTGC[T/C,ATTTCTT]
GGACTCGTCCTTATTTGTTATTCCCACGATGTTATTTGTTCAGTTCTTGCTATATTGGACAAAGGCTCTTAATGACGATGTTTGGCAGGAGGCTCAGGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 43.50% 0.17% 0.13% AAGAAAT: 2.09%
All Indica  2759 32.80% 63.50% 0.29% 0.18% AAGAAAT: 3.19%
All Japonica  1512 85.90% 14.00% 0.00% 0.00% AAGAAAT: 0.07%
Aus  269 90.30% 6.30% 0.00% 0.00% AAGAAAT: 3.35%
Indica I  595 20.50% 79.00% 0.34% 0.00% AAGAAAT: 0.17%
Indica II  465 18.30% 81.30% 0.00% 0.43% NA
Indica III  913 42.70% 48.00% 0.44% 0.22% AAGAAAT: 8.65%
Indica Intermediate  786 39.30% 59.30% 0.25% 0.13% AAGAAAT: 1.02%
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 64.10% 35.70% 0.00% 0.00% AAGAAAT: 0.20%
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 52.20% 45.60% 0.00% 1.11% AAGAAAT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721299763 A -> DEL N N silent_mutation Average:96.295; most accessible tissue: Callus, score: 99.658 N N N N
vg0721299763 A -> G LOC_Os07g35600.1 3_prime_UTR_variant ; 8930.0bp to feature; MODIFIER silent_mutation Average:96.295; most accessible tissue: Callus, score: 99.658 N N N N
vg0721299763 A -> G LOC_Os07g35580.1 upstream_gene_variant ; 187.0bp to feature; MODIFIER silent_mutation Average:96.295; most accessible tissue: Callus, score: 99.658 N N N N
vg0721299763 A -> AAGAAAT LOC_Os07g35600.1 3_prime_UTR_variant ; 8929.0bp to feature; MODIFIER silent_mutation Average:96.295; most accessible tissue: Callus, score: 99.658 N N N N
vg0721299763 A -> AAGAAAT LOC_Os07g35580.1 upstream_gene_variant ; 188.0bp to feature; MODIFIER silent_mutation Average:96.295; most accessible tissue: Callus, score: 99.658 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721299763 A AAGAA* -0.23 -0.03 0.01 0.06 0.03 0.12
vg0721299763 A G -0.07 -0.11 -0.09 -0.03 -0.03 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721299763 NA 5.08E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0721299763 NA 5.78E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 1.41E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 3.46E-06 mr1207_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 3.77E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 6.83E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 8.43E-19 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 4.12E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 4.99E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 3.19E-06 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 6.11E-06 mr1266_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 1.34E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 3.93E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 2.96E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 2.21E-26 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 3.63E-07 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 9.05E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 2.33E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 5.22E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 2.90E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 4.55E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 6.16E-06 mr1740_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 3.53E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 6.72E-08 mr1788_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 2.54E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 4.34E-07 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721299763 NA 6.37E-14 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251