\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721234062:

Variant ID: vg0721234062 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21234062
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAAGCCTTTCTGCTGCATAAGATCAAGTAGGTAGTCCCAACGGACTGTGTCGAATGCCTTTGTAATGTCGAGCTTGAGCAGGAGACTGGGCTTTCTCGT[C/T]
TGGTGGAATTTTCTCGCCAGGTTACGGACGTACATGAAGTTGTCATGGATGCTTCTCTTTTTAATGAAAGCACTCTGAGCATGGCTGACGACGGAGTTCA

Reverse complement sequence

TGAACTCCGTCGTCAGCCATGCTCAGAGTGCTTTCATTAAAAAGAGAAGCATCCATGACAACTTCATGTACGTCCGTAACCTGGCGAGAAAATTCCACCA[G/A]
ACGAGAAAGCCCAGTCTCCTGCTCAAGCTCGACATTACAAAGGCATTCGACACAGTCCGTTGGGACTACCTACTTGATCTTATGCAGCAGAAAGGCTTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.00% 5.70% 7.45% 53.83% NA
All Indica  2759 16.20% 0.10% 8.59% 75.10% NA
All Japonica  1512 62.60% 17.40% 5.69% 14.35% NA
Aus  269 27.10% 0.00% 6.69% 66.17% NA
Indica I  595 10.40% 0.00% 11.60% 77.98% NA
Indica II  465 19.80% 0.20% 9.46% 70.54% NA
Indica III  913 16.30% 0.30% 4.05% 79.30% NA
Indica Intermediate  786 18.20% 0.00% 11.07% 70.74% NA
Temperate Japonica  767 91.50% 3.30% 4.43% 0.78% NA
Tropical Japonica  504 21.00% 35.10% 7.34% 36.51% NA
Japonica Intermediate  241 57.30% 25.30% 6.22% 11.20% NA
VI/Aromatic  96 62.50% 0.00% 0.00% 37.50% NA
Intermediate  90 38.90% 3.30% 12.22% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721234062 C -> DEL N N silent_mutation Average:14.141; most accessible tissue: Callus, score: 58.602 N N N N
vg0721234062 C -> T LOC_Os07g35500.1 3_prime_UTR_variant ; 323.0bp to feature; MODIFIER silent_mutation Average:14.141; most accessible tissue: Callus, score: 58.602 N N N N
vg0721234062 C -> T LOC_Os07g35490.1 upstream_gene_variant ; 3690.0bp to feature; MODIFIER silent_mutation Average:14.141; most accessible tissue: Callus, score: 58.602 N N N N
vg0721234062 C -> T LOC_Os07g35510.1 downstream_gene_variant ; 4207.0bp to feature; MODIFIER silent_mutation Average:14.141; most accessible tissue: Callus, score: 58.602 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721234062 NA 5.50E-19 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 NA 9.52E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 NA 2.92E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 NA 1.02E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 NA 1.22E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 7.77E-08 2.43E-23 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 NA 1.03E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 NA 1.76E-16 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 NA 6.12E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 NA 3.17E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 NA 3.70E-08 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 NA 1.21E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 NA 2.20E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 1.34E-07 8.57E-13 mr1993_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721234062 3.46E-07 5.57E-15 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251