Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0721227076:

Variant ID: vg0721227076 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21227076
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, G: 0.26, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

GGCAGTCACATCCTGCATTCCTAACTTATTTGTCGGTTTGGTCTGTCCACCGATTTTCAACATTTTTCTACATGCATTCCACGCATATTGACCGGCCTAT[A/G]
TGTATCAATATATATTCCTAGCTGGGGAGAACGCCAAACAACTTGTCGCTCTACAACATTGATGGTCGCGTATGGATTCTAGTAGCTATGCATGCATGTG

Reverse complement sequence

CACATGCATGCATAGCTACTAGAATCCATACGCGACCATCAATGTTGTAGAGCGACAAGTTGTTTGGCGTTCTCCCCAGCTAGGAATATATATTGATACA[T/C]
ATAGGCCGGTCAATATGCGTGGAATGCATGTAGAAAAATGTTGAAAATCGGTGGACAGACCAAACCGACAAATAAGTTAGGAATGCAGGATGTGACTGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	35.50%	0.06%	0.36%	NA
All Indica	2759	48.40%	50.90%	0.11%	0.62%	NA
All Japonica	1512	84.20%	15.80%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	19.20%	80.70%	0.17%	0.00%	NA
Indica II	465	81.50%	18.30%	0.00%	0.22%	NA
Indica III	913	43.70%	55.10%	0.00%	1.20%	NA
Indica Intermediate	786	56.20%	42.90%	0.25%	0.64%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	58.30%	41.70%	0.00%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721227076	A -> DEL	N	N	silent_mutation	Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911	N	N	N	N
vg0721227076	A -> G	LOC_Os07g35480.1	upstream_gene_variant ; 1165.0bp to feature; MODIFIER	silent_mutation	Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911	N	N	N	N
vg0721227076	A -> G	LOC_Os07g35480.2	upstream_gene_variant ; 1265.0bp to feature; MODIFIER	silent_mutation	Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911	N	N	N	N
vg0721227076	A -> G	LOC_Os07g35480.3	upstream_gene_variant ; 1232.0bp to feature; MODIFIER	silent_mutation	Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911	N	N	N	N
vg0721227076	A -> G	LOC_Os07g35490.1	downstream_gene_variant ; 2841.0bp to feature; MODIFIER	silent_mutation	Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911	N	N	N	N
vg0721227076	A -> G	LOC_Os07g35480-LOC_Os07g35490	intergenic_region ; MODIFIER	silent_mutation	Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0721227076	A	G	-0.15	-0.1	-0.08	-0.03	-0.04	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721227076	NA	3.80E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076	5.09E-06	NA	mr1970	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076	NA	2.76E-11	mr1970	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076	NA	4.59E-09	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076	NA	1.22E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076	NA	8.54E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076	NA	4.34E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076	NA	7.65E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076	NA	1.42E-07	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076	NA	3.48E-07	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251