\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721227076:

Variant ID: vg0721227076 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21227076
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, G: 0.26, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GGCAGTCACATCCTGCATTCCTAACTTATTTGTCGGTTTGGTCTGTCCACCGATTTTCAACATTTTTCTACATGCATTCCACGCATATTGACCGGCCTAT[A/G]
TGTATCAATATATATTCCTAGCTGGGGAGAACGCCAAACAACTTGTCGCTCTACAACATTGATGGTCGCGTATGGATTCTAGTAGCTATGCATGCATGTG

Reverse complement sequence

CACATGCATGCATAGCTACTAGAATCCATACGCGACCATCAATGTTGTAGAGCGACAAGTTGTTTGGCGTTCTCCCCAGCTAGGAATATATATTGATACA[T/C]
ATAGGCCGGTCAATATGCGTGGAATGCATGTAGAAAAATGTTGAAAATCGGTGGACAGACCAAACCGACAAATAAGTTAGGAATGCAGGATGTGACTGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 35.50% 0.06% 0.36% NA
All Indica  2759 48.40% 50.90% 0.11% 0.62% NA
All Japonica  1512 84.20% 15.80% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 19.20% 80.70% 0.17% 0.00% NA
Indica II  465 81.50% 18.30% 0.00% 0.22% NA
Indica III  913 43.70% 55.10% 0.00% 1.20% NA
Indica Intermediate  786 56.20% 42.90% 0.25% 0.64% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 58.30% 41.70% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721227076 A -> DEL N N silent_mutation Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911 N N N N
vg0721227076 A -> G LOC_Os07g35480.1 upstream_gene_variant ; 1165.0bp to feature; MODIFIER silent_mutation Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911 N N N N
vg0721227076 A -> G LOC_Os07g35480.2 upstream_gene_variant ; 1265.0bp to feature; MODIFIER silent_mutation Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911 N N N N
vg0721227076 A -> G LOC_Os07g35480.3 upstream_gene_variant ; 1232.0bp to feature; MODIFIER silent_mutation Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911 N N N N
vg0721227076 A -> G LOC_Os07g35490.1 downstream_gene_variant ; 2841.0bp to feature; MODIFIER silent_mutation Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911 N N N N
vg0721227076 A -> G LOC_Os07g35480-LOC_Os07g35490 intergenic_region ; MODIFIER silent_mutation Average:79.939; most accessible tissue: Zhenshan97 young leaf, score: 97.911 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721227076 A G -0.15 -0.1 -0.08 -0.03 -0.04 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721227076 NA 3.80E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076 5.09E-06 NA mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076 NA 2.76E-11 mr1970 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076 NA 4.59E-09 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076 NA 1.22E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076 NA 8.54E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076 NA 4.34E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076 NA 7.65E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076 NA 1.42E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721227076 NA 3.48E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251