\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721165825:

Variant ID: vg0721165825 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21165825
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAACACACCATCTCCAAGCACCAAGCTAGCCATCGTAATGCGAATACCTTCATGGTTTACGCACAAACCGGTCCAACCCGTCAACCAAACCATCCCGA[T/C]
CCCCTTTTTGCGGCTGTACAGTTGTACGTGGGGAGGCCATATGTGTGGATCCTGTGCATAATCACCCCGTTGAATCCACCCCCTTCGTTTCTCGAAAGAA

Reverse complement sequence

TTCTTTCGAGAAACGAAGGGGGTGGATTCAACGGGGTGATTATGCACAGGATCCACACATATGGCCTCCCCACGTACAACTGTACAGCCGCAAAAAGGGG[A/G]
TCGGGATGGTTTGGTTGACGGGTTGGACCGGTTTGTGCGTAAACCATGAAGGTATTCGCATTACGATGGCTAGCTTGGTGCTTGGAGATGGTGTGTTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 39.20% 0.21% 0.85% NA
All Indica  2759 81.90% 16.50% 0.18% 1.38% NA
All Japonica  1512 28.40% 71.50% 0.13% 0.00% NA
Aus  269 23.00% 76.20% 0.37% 0.37% NA
Indica I  595 87.60% 9.90% 0.00% 2.52% NA
Indica II  465 79.40% 20.20% 0.00% 0.43% NA
Indica III  913 82.90% 15.90% 0.11% 1.10% NA
Indica Intermediate  786 78.00% 20.10% 0.51% 1.40% NA
Temperate Japonica  767 47.70% 52.30% 0.00% 0.00% NA
Tropical Japonica  504 8.30% 91.30% 0.40% 0.00% NA
Japonica Intermediate  241 8.70% 91.30% 0.00% 0.00% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 41.10% 55.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721165825 T -> DEL N N silent_mutation Average:92.126; most accessible tissue: Minghui63 root, score: 98.076 N N N N
vg0721165825 T -> C LOC_Os07g35380.1 upstream_gene_variant ; 1933.0bp to feature; MODIFIER silent_mutation Average:92.126; most accessible tissue: Minghui63 root, score: 98.076 N N N N
vg0721165825 T -> C LOC_Os07g35390.1 upstream_gene_variant ; 1396.0bp to feature; MODIFIER silent_mutation Average:92.126; most accessible tissue: Minghui63 root, score: 98.076 N N N N
vg0721165825 T -> C LOC_Os07g35380-LOC_Os07g35390 intergenic_region ; MODIFIER silent_mutation Average:92.126; most accessible tissue: Minghui63 root, score: 98.076 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721165825 T C -0.02 -0.12 -0.08 0.02 -0.06 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721165825 NA 4.82E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721165825 1.96E-06 1.96E-06 mr1444_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721165825 NA 3.13E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721165825 NA 1.86E-07 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721165825 NA 8.35E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721165825 NA 9.44E-06 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251