Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721165825:

Variant ID: vg0721165825 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21165825
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAAACACACCATCTCCAAGCACCAAGCTAGCCATCGTAATGCGAATACCTTCATGGTTTACGCACAAACCGGTCCAACCCGTCAACCAAACCATCCCGA[T/C]
CCCCTTTTTGCGGCTGTACAGTTGTACGTGGGGAGGCCATATGTGTGGATCCTGTGCATAATCACCCCGTTGAATCCACCCCCTTCGTTTCTCGAAAGAA

Reverse complement sequence

TTCTTTCGAGAAACGAAGGGGGTGGATTCAACGGGGTGATTATGCACAGGATCCACACATATGGCCTCCCCACGTACAACTGTACAGCCGCAAAAAGGGG[A/G]
TCGGGATGGTTTGGTTGACGGGTTGGACCGGTTTGTGCGTAAACCATGAAGGTATTCGCATTACGATGGCTAGCTTGGTGCTTGGAGATGGTGTGTTTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.70%	39.20%	0.21%	0.85%	NA
All Indica	2759	81.90%	16.50%	0.18%	1.38%	NA
All Japonica	1512	28.40%	71.50%	0.13%	0.00%	NA
Aus	269	23.00%	76.20%	0.37%	0.37%	NA
Indica I	595	87.60%	9.90%	0.00%	2.52%	NA
Indica II	465	79.40%	20.20%	0.00%	0.43%	NA
Indica III	913	82.90%	15.90%	0.11%	1.10%	NA
Indica Intermediate	786	78.00%	20.10%	0.51%	1.40%	NA
Temperate Japonica	767	47.70%	52.30%	0.00%	0.00%	NA
Tropical Japonica	504	8.30%	91.30%	0.40%	0.00%	NA
Japonica Intermediate	241	8.70%	91.30%	0.00%	0.00%	NA
VI/Aromatic	96	35.40%	64.60%	0.00%	0.00%	NA
Intermediate	90	41.10%	55.60%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721165825	T -> DEL	N	N	silent_mutation	Average:92.126; most accessible tissue: Minghui63 root, score: 98.076	N	N	N	N
vg0721165825	T -> C	LOC_Os07g35380.1	upstream_gene_variant ; 1933.0bp to feature; MODIFIER	silent_mutation	Average:92.126; most accessible tissue: Minghui63 root, score: 98.076	N	N	N	N
vg0721165825	T -> C	LOC_Os07g35390.1	upstream_gene_variant ; 1396.0bp to feature; MODIFIER	silent_mutation	Average:92.126; most accessible tissue: Minghui63 root, score: 98.076	N	N	N	N
vg0721165825	T -> C	LOC_Os07g35380-LOC_Os07g35390	intergenic_region ; MODIFIER	silent_mutation	Average:92.126; most accessible tissue: Minghui63 root, score: 98.076	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0721165825	T	C	-0.02	-0.12	-0.08	0.02	-0.06	-0.08

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721165825	NA	4.82E-07	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721165825	1.96E-06	1.96E-06	mr1444_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721165825	NA	3.13E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721165825	NA	1.86E-07	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721165825	NA	8.35E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721165825	NA	9.44E-06	mr1793_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251