\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721144668:

Variant ID: vg0721144668 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21144668
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTGCTGCCGATAGCCCTTCCGGTCCACGGCGGCGCATCACCCCGTCGCCTCCCTGGCGAACGGCGAACCCCCCCCCCCCCCCCCCCCTCTTGGCCCTCC[T/C]
CTCCCTCCTCGCCGTGCTCGATCGATGATATCCTAGTTGGTAGGCCCATCTTACAGCCCATGAAAATTAATCGGAAGGCCCATTTGACAGAACAGCCCAT

Reverse complement sequence

ATGGGCTGTTCTGTCAAATGGGCCTTCCGATTAATTTTCATGGGCTGTAAGATGGGCCTACCAACTAGGATATCATCGATCGAGCACGGCGAGGAGGGAG[A/G]
GGAGGGCCAAGAGGGGGGGGGGGGGGGGGGGGTTCGCCGTTCGCCAGGGAGGCGACGGGGTGATGCGCCGCCGTGGACCGGAAGGGCTATCGGCAGCACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 7.20% 1.65% 3.17% NA
All Indica  2759 94.60% 0.50% 0.65% 4.20% NA
All Japonica  1512 76.10% 18.70% 3.77% 1.46% NA
Aus  269 84.40% 15.20% 0.00% 0.37% NA
Indica I  595 92.80% 0.00% 0.17% 7.06% NA
Indica II  465 97.40% 0.90% 1.29% 0.43% NA
Indica III  913 94.50% 0.00% 0.66% 4.82% NA
Indica Intermediate  786 94.50% 1.30% 0.64% 3.56% NA
Temperate Japonica  767 58.30% 35.20% 4.95% 1.56% NA
Tropical Japonica  504 96.20% 1.00% 1.59% 1.19% NA
Japonica Intermediate  241 90.90% 2.90% 4.56% 1.66% NA
VI/Aromatic  96 88.50% 3.10% 1.04% 7.29% NA
Intermediate  90 91.10% 2.20% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721144668 T -> DEL N N silent_mutation Average:97.432; most accessible tissue: Zhenshan97 young leaf, score: 99.292 N N N N
vg0721144668 T -> C LOC_Os07g35310.1 upstream_gene_variant ; 3935.0bp to feature; MODIFIER silent_mutation Average:97.432; most accessible tissue: Zhenshan97 young leaf, score: 99.292 N N N N
vg0721144668 T -> C LOC_Os07g35340.1 upstream_gene_variant ; 1811.0bp to feature; MODIFIER silent_mutation Average:97.432; most accessible tissue: Zhenshan97 young leaf, score: 99.292 N N N N
vg0721144668 T -> C LOC_Os07g35310.2 upstream_gene_variant ; 3935.0bp to feature; MODIFIER silent_mutation Average:97.432; most accessible tissue: Zhenshan97 young leaf, score: 99.292 N N N N
vg0721144668 T -> C LOC_Os07g35340.2 upstream_gene_variant ; 1811.0bp to feature; MODIFIER silent_mutation Average:97.432; most accessible tissue: Zhenshan97 young leaf, score: 99.292 N N N N
vg0721144668 T -> C LOC_Os07g35340.3 upstream_gene_variant ; 1811.0bp to feature; MODIFIER silent_mutation Average:97.432; most accessible tissue: Zhenshan97 young leaf, score: 99.292 N N N N
vg0721144668 T -> C LOC_Os07g35330.1 downstream_gene_variant ; 359.0bp to feature; MODIFIER silent_mutation Average:97.432; most accessible tissue: Zhenshan97 young leaf, score: 99.292 N N N N
vg0721144668 T -> C LOC_Os07g35335.1 downstream_gene_variant ; 121.0bp to feature; MODIFIER silent_mutation Average:97.432; most accessible tissue: Zhenshan97 young leaf, score: 99.292 N N N N
vg0721144668 T -> C LOC_Os07g35330-LOC_Os07g35335 intergenic_region ; MODIFIER silent_mutation Average:97.432; most accessible tissue: Zhenshan97 young leaf, score: 99.292 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721144668 T C 0.03 0.04 0.02 0.03 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721144668 6.66E-07 NA mr1495 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721144668 NA 6.97E-08 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721144668 NA 1.16E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251